Description :
From Genome Similarity Track
Location :
Scaffold_71:229069- 235832
Transcript NameFunction/comments
Physo_139207reverse transcriptase

Sequence
6763 bases(100 bases per row)
TGGTATCGAGGTGGAGGCGAGGGCGTGGTCGTTGAAGTCTGGGCTGGGCCCGCCGAGGGACTCGGCGCGTCTTGGCCCGTCGCGGAACTCGTCGCGTCTT
GTTTGACGGATCTGGCGAGAATCGTCAAGGGCTCCTGCACGACGCGAATTGCGCGCAGCCAAGACTTGAGGTCCCAATCGCACAGCCTCTCCATCTTGAA
AGCTCCCAACACGAACCCCGAGCCACGCAGCATCTGGAAGAGAGTCGGCGCGGCGTGGGCAACGCTGGTGAGGCTGTCGAAGTCCGGCGCCACGAAGAGG
CCTGTGAAGTTGCTCATCAGCATAGGCTTGCGGAAGACCAAGATTGGGTCTTGCTCTAGCAGACGGAAGATCTCCGTGCGCGCCACGACGTACCGTACCT
CATCGACGGTGTACTGACGTCCCGTGGCCTTGCCTTGCGGCTTGGACAGCGACTCCTCCGCCGAGTCCGGCGCGTGCAGCTTCTTCTTCCTCTTGGGTGA
CTTGCGTTTCGTGGCTGCCTTGGCGGTGGGTTGTTGTTGGTCGTCGGCCTTAGCAGGCTTCCAACCGGTAGGACCGCGACGCAAGTCGCGGTCCTTCGCG
GCTCCCTCGTCGGGAGCCACATCGGGAACGGCAAACTGTTCTTCGTAGCCCTCCTGGTCGTCGCTGGCCCCGTGACCTGTCGTGAAGGTTCCCTCAGAGC
TCCACGACGCGACAGGTCTCTCACTGTGCTCTCTTGCGGTCGGCGACCTTCCAGCCGACTGCACACCTGCCTCCGATTGCTCTTGGATCGTTAGCCCGTA
ATTCGAAGTAGTACTCCCGGGTCGCGGCACCATTGTGGAGTAGCGCCCTCGCAGAAATCTCGCGGAGTCGATCTCGCACAAACTCGGCGCGTCTGGATGG
CTGTCGCGCCGAGCAAGTTATTCCCGGTTGTTGGAGTAGCGTATCTTCGAAATACAGACCCAAGTCTTCGCAAGCTTCGGAGTTGGGGGGGTTCTTGTGG
TGACGCTTGTTCCTTGTCGTAGGGCGTCGCGTCGAGCCTTGGGCGTGCGGCGTTATCGGGCCGGCGTTTCCTCGGCGTTCCCGTCGGGCGTGCGGCGTTT
CCTGGGGCTTGTGTGGCGTTATCGGGCCTACAGGGGGGTCTTGTGCACGGCGGTTATCAGGACAGTGCGCTCCTTCGCCTAGTCAGCGCGTTATCGGGCG
CCCACCTAAACGGTATACGTTTAACGTGCCTTTGTTCCAGCACGGGTCTGTGGGGGGGGGGGGGGAGCACCCGAGCCAGCAAACGACGGGGGGTCGCGAT
ATCGAGGCGGCTCTACTTGCCGGCGCTTGGTGGTTCCCCTGGAACCGAGGAGATCCGGAGGTCTTTGTGGTTCAGAGAAATGTCGGGACTGAGTACTTAC
CCTATCCTATGTCCTTGCTACTGGCTACTCTGTACTACCGCTTGCTAAGCCTATCGTTCTGTGCCTGTCCCTACTTCTGTCGTGCATGCACTACCGTGCT
TCAACCTGATTTACGTGGCGCAATCAAGATCTTACCTCGGCGGGTTTTGCTCGGCGGGGATTAGGGTCGACGCGTTTTGCAGAACCGGGTGTGCTGGTCG
ACCCGTCGGATGATTACGCGTCGCACTGGATTCTGGCACTGTGTCTCACAGCCCATCATCCACGCTGATTTTCCCGTCGAGCTCGGCCCTGCGTCGCGCC
CATCAATCCGCGTCGCGTTCCATCAGCCGCGTCGAGGTCCATCACTCGCGTCCTGGCGCCTTCTTCCTCCGGCGCTCGGCGCGCCCACTTCTTCCGCGGG
GTACTGTACCACACAAGGAGTGGCAGGTGCAGACATACTCAACGAGCCGTGACGAGACTCTGTATGGAAGGGAGATATGTCTCTATGACCTATGGCTGGC
CGAACAGCCACCCGCGATTGAGCACAGGACTTACTCGACGCCGCAGAAGATCGTACGGAGACCGCTCGACGCTCCAATATGGCCGAGAGGTCATCTTCAA
GGTCGTCCTAACGACGATTATTCTTCGCTCGGTATATCGGGTCATGACAATGACCCCAGGGTCTCCCAAGGCTTGGTCAAGGTTACTGAGACTGCTGCAG
ACGTCAAAGAACGTGATGGTATATCGATCGACGGTTCGGACGACGAGGCGAGTGCACCGACCGACTCCGACGCACTGGAAAAGTCGTCGCTTTACCGAGC
GGCCTATGCATCCAAGCGCACCGATCATAACGCCGATAGCATCGAACATGGGGCACAGGAAGCCCCGGCCGAGGTGTCAGGAGCCGGAGACAAGCGTGAT
GATGGTGTTGGAGAGCTGAACGACGATTCGGGAGAAGATCATGACGCGCCAGATGTAACAGCAGCGGTGGAACCCGCCCCGCGAATGGACGGAACAGCAA
CTGATACGAAAGCACGCCCTGAACCAGATCAAACGTCGGTCGCGTGGGGCAACGCCACTATCGACTGGGGTGAACATGATCCTGGACCGAACGACATTTT
AACTGAAGCAGGAACAGCCACGACCGAGGTTAGTACCGATGGAGAAAATTGTGTCGATGGCCCGGACAAAGAGGACCCTGAATGATTACTGGAGGAGATT
TATACCTTGGTCGTACTTGCGATGGTTGCGGAAGGGTTCCCGGAGGTTGATGACACCGCGAACGGGATTAATCTCAGCGACCACGCACAGGAGTCTTTGT
CGACATCTCGACTGATGCCTACCACTCGGATTTGGCCCTTCATGGAACGAGGTAAACCAAGGCACGAGTGCTAATTCTCAGTGGTGGGCTGACAGAGGTT
TAGAAGAGAAACGGACCTGAGATGACGTACCTATGCGCAGATGAACACCGCTCGTTTGTTCGTTTGGGTGATGACCTGCACGCGTGGCGAGGGCAGCACG
ATGTTTGCACGTGGCCCAAGTCGTTGACGAGTTCCACATGCTAATGACGACTGACCTGTTGGGAGGGTAACCCAGTTCGCGACGACAGATGAAAGAAGCT
ACTGGAGATGATGATTGAACTGCCTACGAGGGCTTTCCAGCTCGCAGTGACAGACGGAGGAAATTACTATAATTTGCTTATTACGTGTTAAGCGAACGAG
TCGCGATGGAATGGAGATATCGGAATAGAGCCAGGAACAACGGACGACACAAGCAAACATCGGTCAAACCCTCAACAGACGAAACAAGTGATGATGAAGC
GACTAGGAGGGCGACCGAGGCTTTGGGTGCAGCAGTCGAAGTAGAGCGGTTAGGTGTCAAGATGGAGACGTCAACCACTCTAGCAATGGGGCCCTCAAAC
ACCCCCGAGAGTGCGTCAGAAGCCTCACTAAGGCTGATCTTATCGGTTAGTAAGACGGGTCTTATGGATCTGTAAGACCGGTCTTACGGATTTGTAATAA
GACCAGTCTTAGTTTTCACAAGACCGGTCTTAGTCGATGGACCAAATCAATCACCCTGGCCTTGAAGTGGACATACTGCTGAGTGGAAACGCAGCACGAG
GCAGCCACGACCAGCGAGAAGAGGTGAAGCGAGTGCTGATGAAGCCGATTGGAGGTCGACCGAGGCTTCAGACGCAGCTCCTGACGTGACAGGGCCCCGG
GCATTTACGCCCAGACAAGTGACTGAGCATGGATTTGATGATGAAGTGGAGATACGAGTGGATCTGGGACCGCTACGGCCGACAACTAAGTCTCGTTCAA
GGCGAGTGTACCTGCTGTAGCCTGCGCGGAAACTGTGGGGACCCTGCACGAGAATTGGCGCGGCTTGAATAGATGTGATTGCAACACAGCGGGTCGCTTG
GTGGAGGCTGGGACACCCAGACCTTACGTTACGACCACCGACTATTTGCTGTAAGTGCACCACGAACCACGGTCAACACTGGCACGGGCTCACACCAAAG
AGGAAAAAGCTGAAGGCGCGACCGACGTTTCTGGTGCGGTGGTTCCCGAGCCACAGACTGAGGCAACTAAACCCGATTTGGTTACGACCACCAGAAAATC
GGGGTGGAACTGTGGAAAGAAGGCAACGAAACCACGGTCGACATAGCTACATTATCTACGAGTGATGACGAAGCAAGTGAAGGTGTGACCGACGTTGGCG
GTGCAGCGATTCGCGGGCTTCACCCTGGGGCAACCATTCCTTCTCCCTTTACGACCACCGAAGTTCCGACGTAGTGATGGTGTGAGGCAGGACGAGTCAT
AGCACGTTCCCTGACTACTGCACTTGACGTTGAACCCTCGGCCGACGCAGAACTAGCTACTGCAGATGCCGGTGATGCCGAGAAGTATGCGACTGAGGTG
TGTCGAACGGCGGTCCGCAGCATGTCGATGGAACGTCGGATCATACGACCACTGGAACTCCGGATGTTTTGCATTGCGGCCAGAAGTGTGGCAGGGCATG
TTGCTCAGTTTGAGCCCCAGGTGATGCAGCACTATCAAAAGAAGACGTCAATGCTGTCGAGGAGACTGAGCCAAGGCAGGCCAGGGGCAGTCAGCGGGAT
GTCGATCAAGCGACCAACGTCGGACCATACGACCACCGGAATTCCGGTGATGTGACCATGGATGGGCTTCCGCTTAGAGTGTGGCCGGCTACAGTACGTC
GTTCCGATTAAGTTTACCCGCTAGAGAAGCCGCCAGGGGAGCAGAAGAGAAAGGAATCACGATGCGAAGAGCAGCCGTCAGCTTGATGTCGATGAAACGA
CCAACGTCGGATCATACGACGACCGGAATGGATCTGGCAGGATTCCTACTGCGCGCCCCGTAGCGGCTCCAAGCGTCATCAAACTCTCGTTGGTCCCAAC
AGAAGATGCAATATCACCGGAGGAACCTTGTGGTGTGTCGACCGACGCTTCAGCAGCGACGGAAGATACTGGAGACGCGATCACAGGTGCCGTTTGTGCC
GGTACCGTATTATCAGCGTCAACAGGGGCGCCGGTGGGTAATGAAAGATCTTGCGGCCCTAACCAGCGTTGCAAAGTGTCGGTGACTACATTGACAGCAC
CCTGGGATACCGGAGAACAAGCTGGCGTCATTAACGAGGATCCAACTGATGGCGAAGAGCAGCAAGAATGTCGAGCGTACCGGACCAGAACACTGAAGGT
CCAGCAGAGCGGCGGTCGCAGCGGTCAGGCGCAAGCGCGATAAATGGGCTATAAAGTTTACGGACGGGAGGCGAGGGCAGTTGTGGTATCGGAAAATGGA
GATTACCCGAGCGATTGCCCGACGCCCAAGAATCAAGGTACAATCAAGGAGCAGCCAAGTGCGAGATGGAAGTGGCTGCTTTGGTTAAGCTGACGAAATT
ATCCTCGTTAGAGTGACGGTTAGTGGCCGGAGCTTCGTCGGGTCCTAATACAACCCCGACCGAGGCTTCATGGTGCCTACGTTTTGGTACAGATGCATTT
AGTTACGTACTTTGGCCGCACATATTAGTGTAGCCGCGGTCGTCATTTGATGTGTCCGGAATCGCCTTATTGCGATCGTTCACACTAGATATTTGTATAG
GGACATATGCCTCATCATAGGATGACCAGAACGAGGCCCCGGGGCCTCGGAAAACTCAGTAATAAAAAGACAGTCTTCCCCCAAAGCCAACAAGAGTCAA
GTCCGACTTCGGTAAGTGTAGCTAGCTTATTGTAGTGCCTGGACACGCTCGGCTGTGTGTGGATGCCTGTCGGGGAGCTTATCGTGCATTGACCGAGAGT
TTCCTTGGCAGCGCCAAGAGTTGGCGTGGCCGGGGAGGCAGGAACGGTATTAGAGTATCGTTCGGTATATATTTGTGGGATTAGAGTGTCCCTGAGTGTA
TTAGTCTACCTACTGAGGTTTTACCTTGGCCCCCCTGTATAAGGCCTAACACGCCGGTACCCTTCCTTTCTGAGGGACTGCAGTGGGGTTGCGCGAAAGC
GCTACATAGTATCCTAGCCTTAGCTCGTGGCTAGCGGTACAGGTTTTTGGGTTGACCGAAGACAACCTAAGGTGCACAGAGGCGCTGGCAACCGACCCGG
TGTAAGGGATCGTTCCTGGTCTTCAGGTTTTGATCCAATAAGCGCTTACCATTGCGGGTTAGCGTGTTGTTGGTGCCTCTAATACCTTTTGGTAGAAGAG
AATTTAAGTGGTGTTACCACACCACAAAACTCCTTGCTCCTCAGAGCCTTTAGCAACGCGACACAGGTGTCGTCCTTGGCATAAGCCGTTCGGATCAAAT
CTGGTAATGACGAAGTCAGATCATAATCCGGCCTGCGCGACAGCGCGTCCACAAGGACAATCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTC
CGCCAAGAAGGACAGCCAACGGGCCATCCTTCGCGAGAGGTGAGGTGACTGTGTCGCAGTGCGTAACGATGCATGATCCGTGTAAATCACGAACGGCTGA
GAGCCCAACATGTGCACCCTGAACTTGACGAGCGCATACTTCATCGCAAGTAGCTCTTTGTCATGGACAGGATAGTTCTTCTCCGCAGCCTTCAGCTGGC
GAGATTCGAACGCCATCACGCGCTCGCGCCCCTCGGAGTCTGCTTGCAGCAGTGCACAGCCGATGGCAAAGTCCGAGGCGTCCCAGACGACACTAAACGG
ACGAGCGGGGTCTGCCAAAGCCAGAATAGGTGCATAAAGGAGACTGTCCTTAAAGGCCGCGAACGCATCGTGATGCTCGATGTCCCAACACCACTCCGCA
TCCTTCTTCAGGAGATTGGAGAGTGGCCGAGCCATCTCAGCGTAGTTCTCGCTGTATTTGTGC