Description :
From Genome Similarity Track
Location :
Scaffold_124:22904- 26550
Transcript NameFunction/comments
Phypl_g3668dynein heavy chain

Sequence
3646 bases(100 bases per row)
ACATTGCGCAGAGCGTCTTCCGGCCAGGCGAAGAACCAGTCGATGACCGAGGCCGAAACAAGACCGGGGAAGTTGCGGCACCGGGTCCTGAGCGTGCTAC
CCGACGGAGACATCGCTAGAATCACGTGGAGGTTCTGGCGACACAAATTCACGTAGaacctccagcagctttcGTTCGTCTCCACGAGCCCCGCAGCTTT
CACTTGATCACGCACGGAACTGGCCAGAGCGTCACGCTCATCGGCTTCGAATAGCGCAGGCACGACGCCGGTAGTGAGCATGTTGTTGATGAATTCGAGG
AATCCTTCCTCGACTGCGTGCGCGTCCGTGAAGAGGAATACGACCGGCTTCTTCCCCAGCAAGCGGTACAGGTCTTTCAGGTTCTCTCGGAACTCGGCCT
CGCCGTACCCACGGGTGAGGAAAATCTCAAAGAGATCGTAGCCGGCTGTGAACGCTGCTAGTCGCGACAGACTCTGCTTCCCACTACCCCCCACACCGAT
CAGCAGAGCGTGGCCTAGTGGGTTTCGGATAATGCGGAGGATGCGTGAcaagtgctcgagcgccaTCTCGAACAGGACCAGAGTCATGGGTTTGTTATCC
AAGTTGTACGTCTCCAGAGCTTCGTCGAAGATGCCACGAATACGGCGGTACGACTCCATGTCCTGGTACAAACGAGCATCTTCggttgctgcttggccgG
TGATACGGCCAACGCAGTCGGCGTAGTCGCCAAAGATAAGCGGATCAACCGAAGCTGCCTCAGCTTCGTCGGGGAACGTCTCACGCAGGATCTGCGTGAT
GGCGCCGTCCACTAACGCGTTGTCGGACTCACTCGTGAGTCGATCGCAGAAGATGCGCTTCACTTCATTACGCCACAGACGCACGATCGTGCCGGCGCTG
TCGAACTTGTCGGTCGTGGCCATGCAGACGCCCTCGCACACTCGACCGAGGTCGCGCAGGTTGAAGATGTAGTGGAACTTGGATGGAGTGGGCGGCAATT
TCTCGAGCGTGAACTCGAAGAActgaagaagcgcttcgGTCAGCTTGACTCCCTTCCCTtggatctcgtcgctgaagtTACGCAGGTACGTGGTCACGAT
GGAGCCGTAGATGTGCTTCAACACCTCTTTTGTGGGCGGGGTGAGGTTGTACACGTTGAATTGCGCTACGAATCGAGGGTCCACTTGGTTCCGGCCACCG
CCAGGAGGCCCCATGGCACCGATGAACAGCAGATCCTTGAGAATACGGAGATCGAGCTCCTTACCGCGGTCGTACATGCTGCCACGGTTCATCACGAAGT
GCAGTAGCGCGatcggctgctgcgtccCGTACAGATCCACTTTGGGCATGTTCaagtcgtcgatgaagatcagcagcttcttcccCGCTGGAGGGCCGTA
AATCTTGCCCGAGCGCTTGTCCACGTTCGCCTGGATGTTCGTCTGCACGTCCAGACTGCTCGTGCGACTCGAGAAGTTGATGCTCAACGTGGAGCACGTC
TGCTGGTCCAAGTCCTTGAGGTAGCTTTGGATCGTCACGGTCTTGGCCGTGCCGCTCTCGCCCACGAACAGGATCGGCTTCTCTGTCCGCATGCAGCTAG
CGAGGATGAAGCTGTAAAGCACCGAGTCCGTTGTGGGGACGAACACGCGCGAGAAGTTGAACGGCGCCGGCTCCGCGTACGGCACGACGCGGGCTTCCCA
TGGCTGCCACTTGCGCGTCTCCAAGTCGAAGAAATTGCAGTACAGACTCGTTGCGGGCAGCGGGCAGTCTGCAATCTTCCGgatgaactcgttgaagcgc
gcgcgACTGCTACCGAGCAACGCAGCTCCAAGTGACCACACGACActgaacaagaagacgcCTTCGACGCTCGCACGGTCCGTCGTCGGGTCCAACGACG
AGTTGTCACCGGgcaggaaggcgtcgagcgagatgcagagctgcttgCACATTTCCATGTTGCTGATCGGGATCACCTGCTGGCacttggccacgacctc
gtcCGCGCCCAAGACGCCTTCGAGGATGAAGTCGATACACTTGGGCACGTACttgtcgaacagctcgagcagTACGGTGCGTTCCAACGGGGTCGTAAAC
GTGccaggcggcggtggtgacgaGGCCGGTGGGGGCGTGTCGGGCGAGGCAGTGACGGCTACGAGCGGATACTTCTTCTTGAGCCAGCGCTCGTAGTACG
GACGATAGCCGAGGTTCTTCGGGTCGACCCACACCATTCCACAACGACTGATAGTAGCGGGCGACGCGTACTGCAGGTCGAACGTCTCACAGATCATAGA
GCAGTGCGTCTGCAGTCGGATACGCTCGCCATTgggcagcgtgagcagcttgttgtCGTCCATGACGCTGTTCATGTTCTCCACCCAGACGGCGTCCACA
TCTCCATCGTAGATTAGCCAGCGCTTCTCGTTATCCTTCCCAGCGGGGAGCGGCTGGTTCAGCTCACGGAAgagcttggacagcacgCCGTCGGTCCAGT
CACGCGTGACGGGGTCCATCGTGCCGTAGAGCTCCGCGATCGGCTGGGCTTTCGGGTTGAGCACGAATATCTTGACGTGTTCGTCCAGCGCGGTcttgga
cgctgctgcgagcgtgttgagcacgagcgtcttgccgcCACCCGTGGGGCCCACGATCATGGTCGTGTGACGCACCAGCATCGTCTCGTACATCTGAATG
ATCTTGTCGATCTGCTCGTTGTACACGGCGGCGTTGGTCGTGTTGTActctccagcgacgagttccgcTTCGATGGCGTCTTTCAAGGCTGCGTAGCCCA
CCCGCGGGCAGTCCAAGCCGGGGAACAGGTCGTTGATGAGCCCGTGGAACAGCGGCACGTCCTCGAACACGAACTTGGGCATGTTGCTGTCACGCAGCGC
ACGCATGAGCACCAGGTCCTCGTTCATGTCGCTGTactcgcgcttgagcgcgcCAGCCATGACCAACACGCTCTTGAGAGCTCGCAGACCGAAGTCGTAG
TGGAACTGCTTggagagctgctcgcgcgaAAGCTTGTACAGCAccgtcatcttcttggcgaggGACACGGCGTTCTCGAAGCCCTCCGAGAAGAGCATGA
TCTGGCAGATCTGCAACAGGTCGGGGACGATCATGGTCACCGGTCGGAAGAGCGCCTTGAGGTTGTCCGGTAGCTCCGTGCGTCCGGCGTAACCAGGATT
CATGGTGATGAAGAACCCACACGTGGCGAAGCCTGCAGTGCGATGGATGGCGATCTCCGTGCCGAAGCCGATGTCAACGGTGGGTTTGTCGGTGTTAAGA
GCGTTCTGGATAGCGCGGAGCTGTGCGGAGACCACGGACAGCACTTCAATGTTGATACggttgaactcgtcgaaaCAACCCCACGCCCCCACTTGCACGA
GCCCGGAGAAGATGCTACCCATCGCCTTGTAGTCCAGACCTTCGCCGCAGTTGATCACGTAGCACGGCAGTGCCAGCGACTTGGCCAGGTCTTTCACCGT
CTCGGTCTTCCCCGTACCGGCCGGACCAGCGGGAGATCCTCCCAACTTGAACGTTAGCGCTTGAGTGAGCGTCATGTAGCAACGATCCGTGAGTGGGGTG
ATGACAAGTCGTCCGTTCAAGCCCATGTACTCGTAGCCGTAGCGGA