Description :
From Genome Similarity Track
Location :
Scaffold_2:229027- 230203
Transcript NameFunction/comments
g1358.t1XP_008890249.1 hypothetical protein PPTG_00589 [Phytophthora parasitica INRA-310
g1359.t1XP_002902195.1 nitric oxide synthase-interacting protein, putative [Phytophthora infestans T30-4

Sequence
1176 bases(100 bases per row)
CACGCGCCTCCTCACTTTGGACAGGGAACCCAATCGCCGACCACACGCCCGTCTGCATAGTGTACTCAGCCAAGTACACAGTCGCCAGAGGGATAATATA
CGGCCCCAGCGTCATAATGAACCTCATCTTGGCTCGGAATCCCATCGTCGACGCGTCGTGCATCTCCCCATTGCCCTGTTCCACCTCCTTCTTTCTCGCT
TGGTCTTCCGCGGCATCCACGGCCATGACGGCCACAGCAAACCCCACATCTTGTGAACTTTCGGGGATTGGCATGTAGTTGCACGTCCTCGCCGGGGGCA
GTTTCGATCCGTCAAGAACGAAGAGGAACACGAGCACGTAGATCACCGGAAAGACAATGGCGAGCTCCAGTGTCGTCTGGAAACTGAGACCGCCCCAGAT
GTGCAAAATACCCACCCAGGCGTAACCCCCCACGCCCGCGAGCCCCGTGCCGCTTGACCAACATGTCAAGCAGCGTACGGGGCTCGAGTAGAAGGAGGAC
ATGGCTAGAAAACTCGCCTCCATCATTCCGGACTGAAGCCCCGAGAAAGCGACCCCCAGAAGTTGCAACCATAGAGAATTCCCCCCTTTGGCGACTACCA
AGAAGCTCAGCAGCATCCACACGGCGCCGATGATGGTGCGTTGACGGTACGACACGAGCTGGAACCAGTAGGGGCCCGAGAGCTTCACGAGCAGCGCCGG
GAAGATGTCGAACAAGTAGACGAGTCCCACGCCGCCCGCCGCGATCTCCTGCGCACCCGCAATCATGATGACGTAGCCGATGTTGTTCACGAAGCCCAGC
ACCCAGAACGCCAGCAGGTTGCGGAGCTGCTCGGCATTGTGCACCTTTGTCATCGAAAGAGTATTTGGTGTGTATACAAACATGTTTTTATGTCGAGTAC
ACCAATCACTGGTGTCAAAGGTAATAATACGCTGGTAGTGGCTCGAAGGAACACCTTACATTCGCCATCATGAGCCGGCACAGCAAGAATGCGACGGCGA
CAACTCACTTCACATACCGCGAGCGGGAGGCAGCGGGTCACGGGACGCTGAAGCGGCGGTTCGGGCGCGACGCGCAACTGGCGTTCGGCGTGTGCTGCCT
GTGTCTGGCCTCCACGCACAGCCGCAGTCCGCTCGTGTCGCCCGCGGGCTTCGTTTACTGCAAGGAGTGCATCTAC