Description :
From Genome Similarity Track
Location :
Scaffold_83:22901- 26417
Sequence
3516 bases(100 bases per row)
ACTGTTGGTCGTGCGAAGAATTCCCACGCGACCACACCTCACCTATCCCCAACTCGGTCAAGACAGACATCGACCTCAAGCCACTTGGAAGAGTGCAACT
CGCCCGCCGACAGTTACACCAGGTGAGAAGGAACAAGACAAGACACACGGTCCGGATTATCACCTCCGTTAGTCGGTTGTCCGGGCGCAAGTGGAGAGTT
GGGATCGCCTCGCAAAATGAGCGAATCCCACTCCACCACAATGGTGTGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAATCCCAGAGCGAA
GATGTAAAGATCAGGGTTGAACCGGGGATGGAAGGGTCGGCGAAGAAGGGATCGTCGCAGACACGTGATCATCAAGGATTTCGGTTCGCCAGAGTTTTGG
GAGGGGCTCGGTGAACCGGAAATTAAAGAGGAAGATCACCCAGGTGATCTCGAAGAAAAACCTATATTCCCTCCTGAGGTCCATTCGGGGACCACCGCGG
ATCGTACTGCAGAGTACGACCCGCTAGATGGAACACGTCCAGCCAAAGCTGGACATATTTCATCTAAAAACAAAACAATATACAAAGAAAAAAGATCAAA
GGCTGCAGCTCAGAAGTTACGAGTGCCTGACTCCGAAGGAGAAGATCAGGAAACGAGTGGGGCAAAAGAGGTCAAGATGGAAGGCTGGAAGATGGATCAG
CGACAACGTCGTTTGCAGTGAACCCAGCTTCAAACTTGCTATCAACAGATCCGGTACTCACGATATTGGAACCGGAGCTGATCGGACCGACCCGAGGACC
TACAATGGCACCACGAGCTGCCAAAAGCAAAATGGAAGCGGTACAACGCCTCATTCAAATGCTACGAGGTACAGGATTTGTACCGGGGGCGTTCTATGCG
CAGGTTTTGCTTGACTGTGACCTGGATCAGGTGATCACGGCCAGTCGATCACTGTTAAAAGCGCTGGTCCCACTGACCGGTAATTATGACTTCGCTGATC
GTGAACTCACTACCACCGTCAAGGTCAAAGAGGAAGAACATTCCCCGGTTGTGTCGTCGCATTACGCCTCTGCGGAGTCGGATGCAGAGGAAAGAGATGG
CATGGAGATCAAAAGAATTTCGTTGGGACCTTCCGGAGCAGCACTTTTGCGTGACCACCACGAGCATACGGCACCAACCACCAGGGAGATGGGCTCAACC
ACTACGTAAGTCCCTGCTACAAATGAATCCGACCAGATGCAAATCTACTTTGCAAAATCCATGGAAAACTTCTTACAGGACCACCGTCGACCGCCTCGTA
CCGTGCCGACCGGTGGCCCGTGTATACCAGACACCGACATGGAATCAGCTTACTCGCATGACAGCCGCGGCAACGCATTCGACCCTGCCGATCTCGATAT
CGACGACAACCCCACTTGGCTACCACAGAGGTCATAACAGGGGAAGGGTTTGCTGCGCAGCGGATTCGCATGTCTGCGATTGATGAGCTAAAGGAATTTT
CAGGCCGCGATCACGACGATGATCGAGCTTGAGGATGGGTACGCAAAGTCAGGTCAGCTTTCTTGCGTGACCAAGCCCCCGACTCGGAAAAGTTTCTGTT
TTTTGGTGATCTGCTAACGTGCCCAGCACGAAACTGGTACGCCCAATTGAGTCGATCTACACGCAATAAGTGGAAAGACTTACTCAAGATCTTCCTCTTA
CAATACTGTGGATGCGCAGTCTCCGCTGGTCGCCAGTATTATCATGCCTGCAAGCGTGCCGACGAGAATCCGTTAGAATATCTCTACCGATTGAACGTTG
CTGGGATGCGAGCGAAGATTCACGTGAAAGACGGGAATATTGCTGATCACCGTGACCATGTGGAACACTATATCGAAACATTGGACGATCAAGACCTCGT
GAACCAATTAACGCTGCTGCAATTAGATGACGTGGATACACTGGAAGCAACGGTACACACATACGAACGTATGCAGAAACGCAAAGGCAACCTCCCGACC
AGTTCAAGCAAGTTCTGCTCATGGTCAGCATCACCATACACCCCAAGTCCATCTAAACCGGCTCGAGCCGTACATGCAATTCACGTGGGGGGCGAGAGCA
GTTCTTCGGAATCAGATATAAGCGGTTCAGACTCAGACGAAGAACAACAGCATGTTTACAGCGCCACGGCAGCCGACCAAACGATGGATCGAGCAAATGA
ACGTCCTACCAAGCCAAGACTGGGTGACCGGGAGCGTGATCAGTATTGTGCAGGAGGACACAAGTCGTGCACTCATTGTGGGTCGAAAAGAAATGTGGAT
GCTGGAAACGATTGACTTGTCAGAAGTGCGGAACTCGAGGTCACCTATTCGACAAGTGTTTCTACGGGTGCGCAGCGTGTGGAGAGGTACACGACGAAGG
CAAATGCCCAAGTGGTACGTGCCGACCAAATATTCCGGAATGCTTCCTCCTGACGCTGAGAAGATGTTAAACTAGGACGCTCGGCAGGTTGGAACCTGGT
ACGAACCAAGCTTTCTAGGCTATGCATATATGCATTCATTGAGAGAGAAGGGGTTGATAACAGTGTTAATAGCCTGAACGGCCGAAATTTCAGTACATGT
GATTTGGATTCTAGTTTTTTTCCTTCAATTGCAAGTCTGCGGCGACCGGACGAATACGCACGATCACCCACCAAGATGGAGCTCAAGTTGTCTCCTGGCG
AATCACGTGGTTACTGGACGTATCATACTCCAAACAAGTGGTTCAGGAAAGACAAAGTAGGGGAGAAATCAACAATGAGAAGGCCACCCTACTGTATGAC
TCGGAAGCTGAAGTCTCAATCATCGACACACATTTGCTCGTAAGGCTGGCTGTGTCATAGACGAGAGTCAGAAGCAAGAATGTGTGGGTATTCGAGAGAA
GTCATTCATGGTCGAAGGCCGCACGAATGTGAAGATCACGCTGAATGGGTCACTAGTCTACTACTCTGATTTATAGGTCGGTGACCAAGTGGGACAAGAA
TCAATTCTAGTAATGGATTTCATGGTACCGGACGAAATACGCCTTGACCTGGCGGACAGGACAGTTTGTTTGCCGGACGAAGTCAGAATTCAACTGGAAG
TTAGAATACCACCGTATGGGGCGAATATACATCGAATCGCTGCAGACGAAAAGTACTTGGCGATCCTGGTGGGTAACGCCGTGGAAGTCAATGTTGGTCG
AGGACCACTGAAGCCGAAATCGTGGCTAACACTCCACTCACGCTGGGTACCTACAGCTACGACTGTACCCGGAAGGCTAATGTACCTTCGATTGACCAAT
CTGACCGATCGAGGTGATCATCCAACAAGGGACGCCATTCAGGCAATGAATGCTGGCGGATATGATACCGCGATCACCCGGGTATGTGTCCGTGGGATAA
CGGCGATATCAGGAGTGGCAGACACTTTCGTTTGAAGCTACTAAGGACGAAGAAGAAGAAGAACTACCTGAAGTAGATGGACCGCTGGTCGAACACCCGT
CATATCCAACGCCAAC