Description :
From Genome Similarity Track
Location :
Scaffold_141:22901- 24958
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-snap-gene-0.14Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_141-snap-gene-0.22Conserved gene of unknown function

Sequence
2057 bases(100 bases per row)
AGATCACGCTCGGGTCTCTGGTGACGTTGACCCAGTTCGTTGAGTCCGAAGACGCGCAGCTTGGCGTTGTCGTGGCGATTGATTTTGTGGTGAAGAAGCT
CCAAGTCCTCTCGGTGAGGAAATCCAAGGGCGCGAAGACAGAGACACGCGAGCAACTCCGTTTCAACGATGTGGTGATACATCAGGATCAAGTTGGAGAA
AAACTCGAGCCATTCGACAGCTCTGATGGGAGCGACTGGATCGGTTTGCTTGGCGAGTACGCGATTTGTGGGGAATGTCGACATGTTTTCCATGTCTCCC
AGGGCGACCTGCAGTCCAAATTCGCCAACGAAAACGTTCTGCGCACGCTCCAGTTGGAAATCGAGACTCTTGTGATGCAGAAACAGCAGCAGATTCGCTT
GAACAAGTGCGAGTTGGTGCTCGAGACTACCTCTGAGATCCAACGCAAGAAACAGCAGATCCAGCGCGCGAGACGACAACTGGAGTTCCTCAACCCGCTC
TTCTGTCCATTCTGTGGATGGAAGCGTCCTGAGTGAACAGAGAAGTCAAATCCACGCTTTCAAACACAGCAAGTGTATTCTCTCACTTGTTGATAACTCT
AATAAAAAAGCAGACAAAGCACTGTTGCCACCACCTATTTTCCTCATACTCTCGCGATTTTTGCTTAAATACATCGCGAGATTCAATCGTATGGACACAC
TCCATTTTCAAACAGCAACGGGTCGTCTGTAGGTGCTCGGGAGATTTTTTTACATAATCGTGCACCAGGCGTCTGAAGTTTCCGCTACCATCCCGGTCAT
CTCCGTGTCCAAGTGCTTCATCGCCTGCGCCACGTGGCTCACAAAGTACGGCAGCCACATGCGGTCGTAGAGGAACCGCGCGGTGAACGGTAGCTCGTCC
TTGTACGCCTGCGCCAGCTTGTCCCCACCCCAGATCCGGCATCGCTCGACGATCCAAGGAATCACAACACGCTTCGGTTTGCTCGCGCGGAATATTCGCG
GCACGACGTATCGCTGGAAATTCTGCTCCGAGAAAATGCGGCCGAGTAGCGGGCTCAGCACTTTCTCTTCGGCGGTCAGGATCGAGTTGATCAGCAGGTT
CAGCTTGCGGATATCGCTCTGGAGAACAAATAGGCGGTCCTGCCAGGAAGTCGACCCGGACGCTGCGGAGAACACGATGTAGTCTTCCTGAGCGCCGATC
GCGTCGAGCACTTCAAAGATCCGCTCGTAGCACAAGTGGATATCGCGCTTGATGTTGTAGTCAATCTGCAGCAGCGGGAGCAGCACTTTAGTCTTCACGT
CGTGCTGGTTCTTGACAAATTCGACAAAGTGGGTCTTGAACCACTGGAAGAACTCGCTCACGTTCCACTCGGTCGGCGACCCGCGTCGCTGGATCCGCTC
GAGAAAGCGGTCGATCACAAATAGCGCGTGGCGCACAGGCTCGTGAATACCCAGCAAGAAGCGCGCATGCCAGCTTTTGTTCACTTCGTTGTGCTCTGCA
AGTACGGGTGAGAACACGATGCTGTCTCCTCTCCTGAGCGGTCCCGATACTGGGACGCTCGTCACCCTCTCCAGGTCTTCTTCTGAGATCCCCTTCCGCA
ATCGACTGCGCGCGCGATACGAATAGCCCGCTGCTTCCTCTTCCTCGGCTGAGTCTAGTACTGGCGCGGAGCTGGACAAGTGGGTCGTGCGCGCGTCGTC
TTCGTCAGCCTCTGAAATGTTGGTGAGATTGCTCAAGTAGCGCTCCGAGTGGCCTGCCTCGACGCTCATGCTGTTCGTCGACGTGGCTGAGTATGACTCC
ATGGTCCAAATGTTCACGAGCTCAAAGTCGCTCGTCGACTCGTAGCCGTCTTTGAAGTCGATCGTCGTGACCACGTATGCAACCTGGCTGATGTCGATGA
ACTTTTGCACGCTCTCTTTGTTCCGGCCCGCGGTCGTGGGCGGCGCAGTCCAAATATTTGTGTAGAATTCCGTGTTGTCGGCGGGGAACTGCGGCGGGTA
CTTCTTCGCGTGCAGACTCTTGCCGACGACCGACAGCTTGCTCTTCTCGAGCGGCTT