Description :
From Genome Similarity Track
Location :
Scaffold_79:22900- 29746
Transcript NameFunction/comments
Phyag_g1696hypothetical protein PHYSODRAFT_492835
Phyag_g1697hypothetical protein

Sequence
6846 bases(100 bases per row)
GTCCACAATGGGGAAGGGATAGTCCTTCCCAATGAGGCACCCAGCGTCGCGCTGTACTTTGAGCGGCGCCTTCCACGGCTCGTGCACGAACTTGTCGGGC
ATGCTGCGGAGTGCTGGGACGTACTTACGGACGAACGCCCCTTGTTGATCCCACTGCTGCGGAAACGTGGACGGAGACGCCACTCGACGGtagttcgaga
agaagcagcttgcGCTCACCCAGAGCCAATTGCCAACGTTCATGGGCCAATCCATGTCCACTAGCTTCTCCTGGAAGTACGCTGCTCCTCGCAGCCACGA
GATGTAGAGCGCTCCTCGCGTCAAAAAGCAGGCGACTGCGTGACGTCCAGCGTGGTGAGTCCAACCTTCCTGGTTGATCTGGCGCATGACCGCATCAATC
CACGGGAAGCCCGTACGCCCGTCCTTCCAacactgcaactgctgcatcgCGAGTTTCTCGTCCGCGTCCGACACGACAGTGGATTCTTGCTGGTCATACA
GGTATTCAGGTCGCAACACATGCTCTTCATTGAGCAACCTCCACTCGATCTGTTTACAACCGGGGTTCCGTTCCTGCGAATCGAAGTTGGGCGTGCCACA
CGCATAACAATAAAAGAACTCGCGCCACATGAGCTGACCTTCAAGTGTGACTTGAGTGGGTCCAGGTCGAAGCGGGAACTGTAGCTGGATGAACATGATG
CGGTAGAAGAACTCGCGTGCACTCAGACACCCGAAACATAAGTACGCGCTGAGAGTCGTCGTAGAGGGGGCGTCGACTGCGACGGGGGATGTTTTCGGCT
TCTCAAACAGCCCGACACGGCGTTTGTCCTTGCAGAAGGCGTCCAATCTTTTCATTGCTTCGCTTTCTCCTCCAAAAAGTGGCGCGTGAGGGTCAGGCGG
GGTCAGTCCTAGCACAGTGAGAGGCGGCACAACGAACATCGCAGTCTTCTTCGCATCACGATCAACCCCGGCCATGATATTGATAGCGCTTGGATCTTGT
TGATTGAAATCCTCCAATATTTTAAACAATCGGGTAGCACTGAACACCGCAGCATTAGAAAGCTTCGTCGGCGCATCGATTGGCTGTGCCGGCTGCTGCA
TATTGTCCGTGATCTCCAGCATCCGCTCGTAGTCCGTTGGTGCTCGACCGCCATTCAATCGAATGATTTCGTGCGGGTCGTAGAGCGTCACCCCGCGGgt
cgtcgtcactttcaCATCCAGAGACTTGGCAATAGCGTGTACGTTGTCGTCGCGCTGCACAGCGTATGGCATGACGCCGGCCTCGAAGAAAAGGTCCGTG
ATCCCCCACGCCGCCAAGACAACTCGCAGCACTTCCTCCGCCTCCCCGCGCAGTACCAACAACAGACTGTGTAGATTTTTCAATGACTTTGCCAAATCTT
CGATGGCTTCGAGTAGAAATTGAAACCTAATGGCCCCACACCGCAGTCGCTTCGGGCGATGTAGAATGTAAATGGGGATCAGTGCCATctcttcaccttc
atccttttggagctgctcctgTGCGCGAATCGCTGCATCTAGCGCCAAGTTGTCGTGCAGCCTCAAATCACGACGGAACCAAACGACCGCccgtcgtgga
ggaggaggaggacgcggcGGCTTGACGTCCTGTTCGGTGGtagtggcggcggcggtggtggtgacctcgtccttctcccGCTTCACCGCGTCCGTCTTCA
ATTCACCGTCGAGCGTATCTACTGACGACAACGTCATTGTTGTCGTACCCGTAATGCATGGGGAATTATTATTGCTGTCATGAACGTCCGCGTCAAGGCG
GATCCAGTTGCTATCGTTGTcgttctcctgctgctccagcggcgTCGCCCGTACCGCCGGGTTTTTCTGTTCAGATTGCACCGTTGGAAGTCTGTCGGAG
GTGGCTGAGTCACGCGTCGATGCACTGCGCTGCCGCTTCCTGGTCATTGACACAGAGAGGGGGAAAGAAGTATGGGCCTCGCGTCGATGGTGAAAGGATA
ACTAACTGCAACAAAGTACCAGGAACCAGAGGCGACGATGAACTTCGGTAACGTTGGCACGGCAAGCGCTTACGAATTCGATCGTGTTCAATTGGTCCCA
ACGACTACCTTCCAAACTTGATATTCATTAACTCAGATGACATAGCAAAAACAAGTGAATGGAAATGGGATAGTTTATAGTGAATCGCCAGAAATCTTAC
GATCAccgaaatggctacatccaCTTCAATTTGCCTCTCTATAAGAGCCAATTAGGTGCCGAAACAGtcgcgcagcaccaactgcagcagttcgtcgcTG
CCGAGTGCGGCGCGCAGGTTCATGCAGTAGGCctcgaagtgctggaacGAGACGACGCCGTCTCCACTGCCACCTGCCACCTCAAAGTTGAACGCGAAGT
CCTGGAACACTTGAGCAGTCGAGGCACGGCCGAGGACCACGTCCGGGTGTCGCGCAGCCTGGAAACTCGACGCCAAGGCGGTAGGGAACACGCGTCCATT
GCCTGCTGACTGTAAAGCCGTGTACACCtgcgtggcgctggccagaCATGCAGGACTAAGCTGCTCGAGCAAACAGTCGAGCACCAGTCGCGCCGGAAGA
CGATTCCCCGCGTTGTCATACCCATTGActcggtgttgctgctggaggaatcGCCCGcctgcactgctgctgtcatcaCCGTTGGCTTGGGAAAAGTGCG
AGAGGTGTTCGAACAGCGCGAGACCTTGGGACTCGCCCAAAGTGAGACTGAGAGCGGCGTTCAACGCGTCGCAGCAGTGGAGATGGGTGACGGTTCCTGT
ACGCGGGTCGGCCGCCTGCTGCAAACGGGAACGGAGCTGTACAACGTCAGCCAGGGAGGTGCTCTGACGGATGCGGTACCGGATTGCATGAAGGACCATA
TCGCCAGCGTAAGTTGGCACAGCTTCGACGCCTAGCGGGGCACCTCTCGACGAGGCCAATCGATTGGGAGCAGTCATACCGGATCCGCTTGCAACATCTT
TCAACGACAAGATCTTCCTCTCTTTGATCAACTGCACAGGAgcctccactgctgcaggtgttgTTCGAATCCCTGCTGCTTGTGATTCTACCGGCTGATG
TGAAAAACTCCAGGATGAACGCGTGCCATTGCCCTTGCTGCTACGTTGGTtgtcttgctgttgctgtggttggGTCGCTGCCTCAGCATCGACATCCGAC
TTGTACGAAGATTTGATAGTGGTGCTATCGAGGTGCCACACGCTGCATACCATCTCTTCGAAGGCCTTGTCCGAAGCGATGCTAGCACTCACGTTGTGGT
AGTAGCTTTGCCACTGCTCCCATGTGACCTTCCCGTCCTGCGCGCCACCATCGATGTCAAACGTCTCGAGGAATTCCCGACAAACGTGATCAATACCCCG
GCGTCCAGCCAGCACGTCGGGATGAGCGCTTGCGTCGAACTCCTCCACAACGTCACTAGGCTCCAGTAGagccttctccacgtcgcgATTGTGTCTCGCC
TTGGCCAATTTTGCGAAAGCCTCACGAACACATTCCAGACGGCGACCGGTTAGTGCTGGTCGCACGATGTTGATCAACTCATCTGGCTCGATACGTCCGT
CACCATCACTGTCGAGATATTGAAAAAGTAGGCGGAGGTCGGAATCTGTAAGACCTCCAGGCAATGTTAGCTCACAATCTACGGCAGCTTTGCGAAGATC
CTGCAAGTTCATGGCATtgcctcgagcagctcggagACGTCGATTGAGGGTGCAGAAACCCCGTGTGCCCTGAGCTTGCAGTACTTGCTTCAATTTGGAC
AATATTGCTTGTACGCCAGCCGGGTGGAGGTGGAATTCACGACGACCAGGTGATGTCAAACCCGACGGAATTTCTGCAGCATTCGGTTGTTGCGTTGGCG
GAGTCTTACCCAGACAAGCCGCGATTGAACTGCTCGCGTTGTTCCTCGCTCGGCGAAGTGTCATGCTTGGACTGGAACccgagctggaagaagccgGACT
ATTCGAATACGCAGCCGAGTGATCCAAGAGTTCGTGCACACTGGAGCGACCAGGGTCTTGTCGGCGTATGCCTTCAGTTTGTACTGGTTTGttacctgct
gctgccgtccgGTTGGTGTACCTAGGGCCGATATGCCAAGCATTACGTACCATAACCTCAAactgctcgtcttcgtcaacCACTGCGCTCACGTTCGCAT
AGTAGCGCTCCCAAACATCGAAGCTCACACATCGCTGGCGTTGACGCTCAGTCACCAAGCCAAACGTATCGAGAAACTCGGCGTGTGCCTCACACTCTGT
CTTTCGACCCGACATTACATCAGGTAGCCGTCTAGCGTCAAATGCCgaagcgatggcagcagcatcaagctCACCACTTCCCAACCGGTCGAGCGCATCG
AATGCCATACGTACCACAAGCTGACGTCGATCGTTCATGGGCTCTCTCACACCAGCGAGGAACTCGGTGACACTCATGGTGCCGTCGTGGTTGCTGTCAA
AGTGGTAAAACAAACTCTGCGCGTCGCGTCCGGTTAGATGAACTCCACTACTTTTGAGTGCGCGAACAAACTCGTGAAAGCCGAGACTGCCGTCATTGAG
TTCATCAACGTAGTCGTCGTCTGGACGTCCGGCTGCGCGACGtagctcttgctgcagcgtgatAAAGCCTCCAAGAACGCGCTCTTTCAGCTCGCAGCGG
AGAGAATGAATCGTGCGACGCAGCTCTTTGGACTGtttgctgccagcaccaggAGAGCGAGGTATCGCTAAGCTCATAGCACTTGTCGGGCTTATAACCC
CCGATGATGGCAAGTGATCTACCGAATCCGGCTGAAGAACGGCGAAAGCTTGCTGGCTCGCCATGCCTGGACCTGCGCTGCGGCGTCCACGCCACGTGAC
TTCGCTACTTGTTGGCATAGGTAGACGCACTGAATTTCCTTGCGGAATCTCGGTCAGTACTGGTGGAGGCACTTGGCTTTTGTTGGCCGCTTGAGTTGGA
GTACCACTTGACGGCAGTCGCCATGTATTGCGCACAATGAGCTCGAACAAATCGTCGTTTGGAACTAGGAAGCTAACATTGTGGTAGTATGCTTCCCACT
GCCGAGGCAACATCTTCCCCTGcgcgccagcaccttcgccatTGCTTTCATCCATGTCAAAATTCTCGACAAATTCACGAAAGCATTCCTCCTCACTTTT
GCGGTATGCAATCACATCTGGATGGCGACTGGCATCGTACCTCTGAACGACGTCGCAAGGATCCAGCCAGGTAGTTCCAGTCTCTCGTGCTAATGTCTGG
TAAGCTGTTTGAACGAGACGCATGCGCCGAGAACTCATGGTTCCACGTACTAGATCCAGAGCACCTTCAACAGGAATCAACCCCGTTCGGTCGCAGTCCA
AATACTGGAAAACCCCACGCAAATCGGCATCACTGAGCGGCGTGTAGTTTtgcgttgctggacttgAGCTTTCATACGATTTctgaagagcacgacgaaa
CTCACCAAGTGTCAGCATTGAGTCTCCATCTGTATCACCTAAACGAAGACACCGTCCAAGCTCAACAAGAGCTTGAATTCCGCGCGCACGTAGACCAGAT
TGTAACTTGCGTAACACCGAAGCCGCCCCAGGGTCCAAGGTATCAATCGATCGAGCTCCTGAACGAACGGTCGAGACCGACGATACCGGCGACGTGACTT
CAGTAAtgcaagcagcaaattgCGAACCCTTGAGAAACTCGTTAGTCGTGTGTCTGGCCGTTCCACGAGGTGAAGCATCAGGGTCCATCGATGAAAGACT
AAGGCTGTTGGTGCGGTGCTGCTCCCTTGGCGATGCTTTAGTGGAAATAGAGAGCACCACCTTAGCATTGCTGCTAGTGTTCTGGTTGGATTGAAGCGCC
TGGAGCAGAGACACCGGAGCTACCGCAGCAggggctgctggtggattGATCAAGTCCATTCGTGCGTTGAGgtcagcaacaccagcagcttcttggagtG
AGCACCGCGTATCAGCGTGCCACACACGCTTCATCAACAATTCAAAGTACTCATCGCTTGGGGCTTGTGCTGCCACGCACTGGAAGTACGTGAGCCACTG
GGCCCAGCTCACGAAAGCGGTGCCCGTCCGTCGTGCTGCAGTCATGAAAGCGGTCTGGAACTCTCGTGCCACCTGCTCAGCAGCCTGCTCTCCAAACATG
ACAGCGGGGTGACGTCCTGCATCGTGCGCTGCTAACGCATCTTGAATTGCCAGATATCCGACGCCTTTGCGATCCAAAGTATCGAAAGCAGACTGAACCA
ATTCCAGCTTCCTACCAGTCAACGGTCCCTAAAAAACCACAAATGCAGCAAAGGTAAGTGCCAACCCCAAGGAATGATTTTTGAGCTTCTGACGTACGAA
GATGAGATTTTTAACCGCGTCGGCTGTGACTCGGCCGTCCTCTTCACCACCTTGGCTAGCTCGTTGAACTAAAGCTCGAGCGTCCTGGAGAGAAACCATG
AAGTTTGCAACCAAGGAAAAAATACTACAAATTCTTGTTCCGTACCACGTCCGAGATCGCCACCCGACAGTCACCGAGCAAGCGCTTGAGTGCGCCAATC
GTCAGTCCGCCACTTTCACTCTGagccttctccagtgcaAGACTCACGTTCACCCACGCGCTGCAACAATAATAAACAGTCAGCAAAAGGTTGCTTCAGT
TTGAGTACCCATTGGACTCACACGAGGCCTTGGGATCGCAGTGTAGAGCGGACGGTGGTCAGTAGCGCCTGCAgatccacctcctccgcgcactgctgct
gcctctccTTCCACTGGGTCAGAGACGACATGGCTCTGCCGTCGCC