Description :
From Genome Similarity Track
Location :
Scaffold_552:2290- 5185
Sequence
2895 bases(100 bases per row)
CAGCTAGGAGAATTTTAACTTCTTCCGGAAAGAAAAGAGTCCCCCATCCCCCAGATCTAAACGTATTTCAGCCCGTACCATGAAGTCCATACCCAGGTTC
GCCTCTTGACCAACTTGGTGACCTACCTAGGAATCAAAGAAGTAGACCAGCGATCCATTTTAAGTGATCTTAATCTTGGTGCATTCTTCTTTCATATACG
TAGTCTCGCCAATACCCACAAAGGTCTGCCTCTGAGTCTTGTCAATGACACGGCCTACCTGACGAGAAAAGGTGGTGTCGACGATCGACAATTCGGCTCC
GGAGTCAAAAAGCATGGTGGCTTTTCGTTGTTGATTTTTACATGCTTTGACCTGTTTGAACCATTTGACTGGGGTATGATACTTTAAATATTACCTCGAT
TAGCTCGACGCTAGATCGAGCTCCATATTGACTGGTAACCGCGATTATTCGTCAAACTAGACGACGTAAAATACTGAACGCGAGTTTGTTGAATTACCAC
ATGTACTGATCGGATCGATCCACTTTGTTAACCTCTTTATCCATCGATCTTTTTTCAACAAATGCATAAATGCGAAGCCTAGAACCTTCGGCTCGTACCA
AATTAATCCTGGTGAGCTTCCTATTTTGGATCCCTTCCGCCTTCGGTAGTAGCATTCCATCATGTTTGGTAGAGGTACCACTCACGGATCAAGTTGTAAA
CCTCTTATATCGGGCACTTTCCACCTTCGTGGACCTGCCCTGCAGGCATCGCACGCATAAAAACACTTTTTTGAAGGTTGTCCTTTTTGCAACCACGTTC
ATGGCACGTCGATCGCTTACAACACGCGATCATCGTGCTTCCTCAATCCGAGCGGGAGCAGTAGCCACACAAACATTGCGTCGGCCCATCTCGTCGTCTT
CTCGACTAAGATCTAATTCCGAATCGCTGCTACCACTTTCTACGTGGAGCGTCTGATCGCACGAGCCGGTGTTGAGGGACTGGGGTCGGAATTCGACGCC
GGTCGCTGTTGGAATTTACTCGATGAATCAACGCTTGGGTTTGCCGCAGATCCACCCGTTTATACTCTAGCAAAGTTTCTTCCATCCCGTCCGCGTTTCC
AATGCGTAACAACGTCATTTGTCTGGCCAAATCGCGATCGTCCAATGTTACAATAAAATGTTATAGATGCTCTTGACGGAAAGCGAATGGCCCATCTTAA
ATATGAATCTTCGCCCGCATCACAGCTACATTCAAACAATGCAAAAATCCCAGAGGAGTTTCTTCCGAATCGTTTCTTCGCCTGGTAATACTGTCTTCCG
ACCGAAATGTTATTTCCTCCGTATTGTGAAAGCAAAATATCCAACAGATCCTTTTACGAGTGACGAATAGATCGGCTTTGCTAGTTGTGCCAATTCCGTG
CGGGACCTGGATTAGATCAACAAACACCAAGCATCTTAACAAATCTGGAGCTCGATCGCGCAGGAATGCAGACTTGACTTTGTTGATCCAGTATCCGCAG
ATGCTACAAATGTATCCTCATATTATCGTTCTCCATACCTTCGGGACGAAGTTGTTGGATAGGGTTTGACGCGATCGAACCGGTTCCATGTCTACATCCA
GAATAACCTCTATGGAGTCATCATGGGCATTGCCGATCTACTCTCGATAATATGGGCTTGATCATGCTCGTACTTATTCATGGCCGTTTCGAAGTAAGAC
TGCAGCTGGACTAATCCCGTCAGGTTCTTATCCGGAACGGTAGGTCCGATCGTCGATCGCACTTTGTTCTTGATCGGTAGCATTCGTTAACGTATGAGCG
CCACACCACTCGCCGAGAGACACTCGTTGGATGTTAATCGAATTTTCTGAGTCTATTCCTGATCCGCCGACGCGTAATGTGAAGATCCCTTGTGACATCC
TTTCAGAATGACGGTAAAATCGCGTCATCTGCTGGCTCGTGTCTTCTGGTGAGAGGAACCAACTTTTAAACAACTATCGCCTTGCGTGAATCTCTTGATC
GTTATCGCATTCCAGCAGTGTGTTCACGTCAAACGCTATCGCATTCCAGCAGTGTGTTCACGTCAAACGCTATCGCATTCCAGCAGTGTGTTCACTTCAA
ACGCTTCGTTGAATCTTTTGATCGATATAGCATTCCAGCAGTGTGTTCACTTCAACGCTTTGATTTATAGTATGCGTAGGAGCTGACACCAGACCTTGTG
GCGATCCAATTAGCTTTAGGTGCCAAATCTCTAACACAAAATCACTGACAGCAACGTCTTTAAATCTCTCTGTGAAAATTGATGTTCATGCCACCTTTTC
GTTTCCAAACCGCGATCAGCCGAATTCTTCTTTTGATCGTCTTGGTCTAATCGAAATGCCTTTATCTTCACCCGCGGCGGCTTCAAACTATTTTTCTTCA
ACCTGGTGGGGGAGGTTTTTTTGGTTGAAATTCTTTTAGTTTTTACTGTTGGAATTACATCCAGCGTATCGCGTTTTGCGGAGCGATCCACAAGGATCGC
CGAGAGGGCCTCGTGAGGGGTTTGGGTTTGTATTCCAGATCGAGCGATCGATCTTCCTAATTAAATATCTTGTCAGTAAATTCCATCCCCACAATCTGAC
GATCTAGAGATCCTTTGTTTTACAAGTGTGCGGCAATCTCTCATCCACTGATGCTTCTATCCCAGGTTCTTTCTTGATCGTGACATCTTCTACGTGGGAA
TCAGGGTGGAATCCCGAGTCACCAGAAGATCCGGGCACGTGCACCACTGTGGTGGAGTAGGATTCGCTCATTTCATAGGCGACCCCGACTCTCCACTGGC
GCCCAGACGACTGACTAACGGAGGAAGTACTCCTATTCCGTGTTGTAAACCTTTCTCACTTTGTGTACCCGTCGGTAGAGCGGGCTGCACTCTTC