Description :
From Genome Similarity Track
Location :
Scaffold_2722:2290- 4324
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_2722-abinit-gene-0.7Reverse transcriptase

Sequence
2034 bases(100 bases per row)
GATCACCGTGAGAGAGGCGGCGGAAGACGTGGAAGATGAAGAAGCTGTCGTGTTTTATCACGAGGGAAGTGACTACGCACTGCTGGAGCAGCTAAAGATC
AGCTCGCGGTGCTTCCAGAACTGGTCGAGATCGACCCACCAGTCGATCTAGCTGGCGCTGACGTCGGTGAAGCTGGTAAAACTACCCCAGAGATGAATGA
AGCGCTCCGGCACGTCATCGCCAAGCACAAGGTCTCGTTCCTAGGTTCAGGTAACGCCCTGCCCCCACCAGCTCGAGGAGTAGTGTGCGACATCGAGGTG
GAACCAGGGACCAGGCCCATCGCAGAGAAACCTCGTCGCATCAAAGCCCACTTGCTGCCGAAGGTGTACGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTGAGCAACTTCGAGGCCGTGATGTGGTTCTTGAGTCTGGATATGGCCAG
TGGGTTCTGGGCCATACTCATGACCCAGCGAGCCAAGCACATCAGCGCTTTCGTCTGCCCACTCGGCCATTTCCAGTGGGTGCGCATGCCGTNNNNNNNN
NNTTGAAGAACGCGCCACTGATCTACCAGCAAGTGATCGACAACGCGCTGTGGGGTTACGTACGACTCCCGCCGCATCTGGAGGCCGAGGTAGAGCCGGA
AGTCATGGCTGCACTGGGCCTCGAACCGGTTGACGAGGCTACAGCAGACCGCTCACTGGTCGAGAACGCCGAGAAGACCGTGTTCGAGCTGGGGATCCCA
TCGCCGAAGTGTCTGGGACCAGTCTTGGGGCGCAGTTCATACATCGACGACATCGCGTACGGCGCCAAGACCTGGGACGAGCTGGTCAACGTGCTTGATC
GGTTGCTTTACCGGCTCCGGTACTGGCGAATCTCTGTCAGCTTGCCAAAGAGTGCATTCGGAAAGCGGGCCATCCAGTACCTGTCACACGACGTGACCAG
GGAAGGAATCGTCGCGACGCCGAAGATCGTCAAAGGCCTGCGCGAATTGCCGTTCCCGACCAGCTTGAAGGGAGTCCAATCGTTCCTCGGAAGTCTGAAC
TACTACAACAAGTTCATCGAAGACTTCTCCGTTATCGCCAGCGTGTTGTACGAGCTGACGGACGACCGAGTCCGGTCGGGTGACCGGCTGGAACCGGCGA
AGCGGGCCTTCGAGTTGCTCAAGGAGAAGATTCTGGCGCCTCCGATGCTCCGGCACCCCGAGAAGGACCGGTCATTCGTGATCATTCCGCATGCGAATGC
GTGGGCAGTCGGTGCGGTGCTGGGTCAAGTACACGATGGCGTGGTGGCACCGGTCCGGTTCACTGGTCGAACGCTGCATGACGGAGAGCTGAACTACCAC
ANNNNNNNNNNNNNNCATTGCTGAGAAGGAAGTTTTGGCTGTATTGCGCGTGTTACGTGTCTTCTACACGCTGGTCGCCGGTCAAGAACTGGTTGTCTAC
ACGCGGTACTCGACACTAAAGTGGATCTTGAACTCGAAGTCGGTCCAAGGGCGCACGTTGTAGTGGTCGGCACTGCTGTCTCCGTGGTCACTGAGAGTGC
ACAAGCTGGATCGAGACGAAGATGGACTGGCGGCACTGGTATCTGCCAGTATCACTCCGCGCGAGAAGCTGGATCAAGTCGCGGCCGAGCTGGTCCCGAC
TAAAGCCATGCGCGTGAAGCCACCACTGGTCAGCCTCGAGATGTTAGACGCCGAGTACACCGGTTATGTGCTCAGTTTCGACGGAGCCGCCAAGCTGAAG
TCGAATGCCGGTAGCGCCAGTTTCGTGTTATGGCGGCTGCCCGGCTGGGAACCGGTCTATGCGAAGTCGATACACCTGGAGGGCGTCACGGTGAACCAGG
CCGAGTACACTGGCATGCTGCAAGGTCTCGAGCT