Description :
From Genome Similarity Track
Location :
Scaffold_3753:229- 2111
Sequence
1882 bases(100 bases per row)
CGAGACGTGGAGATGAGTCCGTGGAAGGGAGACCACTCCCATGATGAGTTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCA
ACAGCCACAGCAGGACAGGTGATGTTCCATGATTCAGAGGTACGAACGCAGCCTAATGAATCTGAAGGAGTTCCACGTTAAGAATCAAGATGGAGGACGG
GGCGGGAAACATGGTTCAGCCAGAGTTCAGTTCGCCCTTTCTGAGAGATTCAAGCTTCGATTGCTGAGAAGTGTTTGACTTTGGCGTTTTTGCTAAGCGG
GGCCACCCAGAAATGGTTTGGGGCAGCTGGGCAGATTCCACCAGGAAACAGGTGGCCCAGATTGGTGGCGCATTTTCCAGAACCCAGTACTGTGGATGGG
GAGTTTTGCGTGGCACACATAATATTACCCCCCCCCTTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTACG
GGTCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGATACGTTGGGAGACGTGGATCTGGCCGACAGGCTG
ACCCTGTTACGACTTCCCGACACAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCA
AGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCTGACGGCTCGGA
CTCCCACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACTGGAGACAACTCTCGACCGGGGGATACCGTACCCGGG
GACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGGGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGA
AACATCTGGTCTGTGAGAAGTATGGCAAGAAAGGCCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTG
CCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGAC
GCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAGCAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGA
TCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACC
CTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTA
AGGTCTGTCAGGTCACTGGAGGATGTGGGATCCATGTATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGAC
AAGCCAAGGTTGGGGGCAAGATCAACAATGAAAAATCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGT
TGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGCAGGCGTGTACCGTACAAACGGTAGAACGCGAATCAAGGTCACGTTGGCA
GGTTGTTTGGTGTACTGTTTCAATATTTTGGGTTGGAGATCTTGCTGGTCCCAGACGTTATCCTCGGAATGGATTTCATGGT