Description :
From Genome Similarity Track
Location :
Scaffold_2:2289830- 2292680
Transcript NameFunction/comments
Phyin_T30-4PITG_01507Putative uncharacterized protein

Sequence
2850 bases(100 bases per row)
TGTCGAAAGCTGCCTTTAAGACGGAAACCTCCCGAGCTGTATTCTATCTCCGGTAATGCATCTTGTCCGCCAACGTGTCTGGGAATAGCGGCTCGTCCGT
TTTGGCAGCTCATTCTCGATTCGGTTTGAGCAAGTACAGGAGGAAGCAACCAGCGATTATGCGCTGTCGAGTAGGGCTCGCTATGATCCTGGGCACAACA
AAAGGGTGGATCCCGGTACTTGGGAGTACAGCCACGTGGACTACGACATGCTCAAGCGAGGCGGATCAGGTATGGCAGGCCACTTGCCCAGTGCGCACGG
CAAAGAACACCATCTACATGTCCCCAACAGGAATGACATCCGCACAGATCAACGCTGACGAGAACAACGCCGCTGTGGCCTACAAAACAGCACGCCAGAG
TGCGCTCAAATTGAGTGCTGTTGCGGGCAATACTGCCATGTCTGGGATGCGCAAGAAGAGCGATAATTGGTACAAGCAGTCGCTAGTGAGCTTTGTCACC
TACATCTGCGTGAAATCCTCGTCGGAAGCCGAACTGGAGCGCTGCGTCAACTCCTCAAGTAGCGATGCAGTGCGCGACATCAACGGCAAGTGTGTTGTTA
TGCTTGATGCCGACTCCTGCAACAGCAAGGGCAAATGCGAGCGCCAGAGCAATTGCAAGTGGGACGACGTTGTGCCTGGCGGGTCAGAAGCCCGTCGCCA
ACTTTTTACTGATGCAGAAGTTATTACTGCGACAAAGTGGATGTCAACGGGCTATCCCAGCTCATTGGCACCTTTCGTGGCCCCTGGCACGGTCATGGGT
GTCCTCACGGCGTTGGGCTGCATTGGTTTTGTGGTGCTTCGTTGTGTTTTCAACCGCTGTGGTGGACGCGAGCCCAACGAAAAGGGCTACACACGCTGCG
ATATCATTGCTCCTACGCTCACCTTCCTTGTGTGTTCTCTGGCAGTCTTCATCTGCATGGTTGTCACAGCAGCGCTGAACACGAACATCTCGGATGGTGT
CGAAGACGTGCTGTACTCGCTGAAAGCAACTCTGGAGAACGCAAACATCTTCGTGTCCAACCTGCTCACTCCACTGAGTAATGCCACGACGGAGCTTACT
GCTGCGTCGACGGCGGTCAATGCTCAGCTCAAGGACTCGGACTGGATTGCTAGGGACGGTGTCACACTTAGACAGATGATCGCAGACTTTGGACGGATTT
ACTACACCACGGAGCGCTCCTATACTGACTTGCGATCACGCGACTAGCGAGACGTTCTGCTTAGCCTGCCCCGACAGAGTGTGCGGCTCTCCTGTCACGT
TCTTCGTCAACAACACTGCCGCTGCTATATCTGCTAGCAGCGATGTGGTTGGAGATATTGTCAACTTGTTGCAAAGCTCATTTGTATCTGGTGGTAGCAC
CCTCAATTCAACTTTGCGCACAGCAGTACGGGATTTGAAGGCGCTGGGTGCGACGACTAACAGCTCCATGGATATTGTGGATGTGCTCACCGCCACGTTT
AACGACTTGTCCTTCTCTCGCAGCGCACTTGTGGTTTGTGTCTTCTTTTTCGGAACAATCGCGTCGATTGTGGGCATCATTGCCATCGTCAAGAACGCAT
GCACCAGCAAGACGACCAAATGGGTACACTTGCTCCACGTCAGCTGGTCCCTGGGCGTGCTAGTGTGTGTGCTGAGCTTTGTCCTCTCAGCGTCCCTTCT
CGCTGTCGGCGCTGTGTGGTATGATTCGTGTGAATACATGAAATTGCTGCACCAGGATATGTCACCATACGCATCGACACAGATGGCCACCGTGGCGAAT
GCATGCTTCAACGGCAGCAACATCTTAGCGCCACTGGGCCTTGATACTCCGCTGGCTTTCTCGTGCAACGTAGAAGATGAATACAAGGATCTTCAGGGAG
CAGACACGACCAGTCTGCCAAGTATCGTCTCGACATACGGCGAGATTGTCTCTAACTATGATCTCACCGACTTCAGCTTTAACTCGACGAAGGCGCGAAG
CCTAGTGTCCAAGCTTTCCACAGCAGCTGAGGCTGCGAAGAAAAAAACGGTTGTGAAGTTCACCCAAGAGAATGTGTTGACGCCTTGGCTGGCGTACAAC
GAGCTGGCTACATCCTATGGCTGTACAAACAGAACCATCGACGAACTGCCCGTGTGTTACATGACCGGTCTGTGTGAATCCGACACGACAGCTAAGACTA
CTACGCAAGCTTCCTGCCAGCTCGCCTTCTACGAGGCGTACGAGTACTTGGTGGCCTTCGACAAGGCAAGTACGATGCTGGACGAGATGCGCGAAGTTCT
ACTTGGTGACACGGGCAAAACGTTCCCTGACCAGTGGAACTACTCAGTCTCCATCAGCGAGTTCGCCATTAACTACTTCACAAAGATCACGGCTCTAAAG
ACCGGTGTGCTATCGAAGATGCTGGGCGAAAATGGTGCTGTGCGCAACCTGCTGACTGCTGTGGAGCAGACGCGCTGCTCTGGCGACTGCGCGTGGGCGA
ATCTCTCGTTCGACGCCATTAACGAGGCGCTCTGCAACAACGTTCTGGGCACGACGCTGGCTATCTCTCTCTGCGCGCTATTTATGAGTGTGTTTCTATT
GCCACTCATCATCTCGGCCATTATCCTGCAAAAGCGCCTGCGCGGAGTGGCCAAGGGCACTTACGACCAGCTGGAGGCGAGGTTGCAGGAGCTGGAGCGC
CGCGCCAAGCAGCAGAAGGCTGAGAGCGAGGGCATCGGTGGCGAGAGCGCCAAACGAGTGGGCGGCCTCAGTGCGCTCGGCGGACTGCTCAAGGGCAAGA
AGGTTCAGCAGCCTAGCAGCCCCTAAACTACAACCACTTCAACCTAGCTA