Description :
From Genome Similarity Track
Location :
Scaffold_65:228978- 230610
Transcript NameFunction/comments
Hyaar_Emoy2807555myosinlike protein putative

Sequence
1632 bases(100 bases per row)
TGAGTGACACCACGTTTGCAGTCGTGCTGTCGTCTGTCATCGCATCTCGCGGTCTAGTTACAGCCCGCTCGCTGACTTCTGACGCGCTAGCTTCTGGGCC
TTCACCGAGGCTAGTGTAGGGCGCTCGAACTGAGACTTGCCGAGCTTGCGGTTCACATAGTACACGCGGCCCGTTGAGCGGGACACCTTGGCCTCCCAGC
CAACAGGCAGGGATACCTCGGGCAGCGCATCCAGGTTGAACGACTCGCGCACAGGGCGATCCGCTGGCTTTGCAGGCGGTGGCTTCACTTTCCCACTACT
CGCACTACTCGAGGTACTGACCGTCGCGGACGGGACGCTGTCAGACGTGCCCGCTGTCTCCTCCGGCTTGCTGTTCGTCCGCTTACTTCGAGAATCATAC
ATGCCCTTCACGACCGACATGCGACCCTTCAGACTCGACATGGCTCCCGTCACACCCACCTCGACGCTTTTCACTATCGTGTTGCGCGCAGAGCTGTCCG
TCGGGCTATCCTCACCTTCGACCTCCGAAACGTCAAAGCCGTCGCCGTTAACACCCTTCTTGTTATTCCAGAAGCGGGTGCCTACGCTCATCGTTGGCAT
GCGAGGGAAATGGCGCTCTGACTGACGCGTCTCCGACGTACGACTGTTAAGGTCGTCCGAACCAGTAAGTGAGTCCATCAGCACGGTCTCACGAGGCTTC
TTCTCCTTCTTGGACCCCAGCGTACGGAAGATGGACTTCTTCTGCGTTGACTTCTTCTCAGGCACACCGTCCACGTAAATCTTTGCAAGTTGCTCCACGA
GCTTCTTGTTGTCGGTCTCGAGCAACTTGATCTTCTTGTCTTTCTCGCGCACCGTGTCCTGCAGCTGACGAAGCTTGACGTGATTGCCAGCCGACGAGAA
TTCTTTGTCACTCTTGAATTTTTCAATCTCGACCTTCAAACCCTTCATCGCAACCTTCATTTCTACATTCTTCTCACGCAACTTCTTATTCTCATTCGTA
AGAGTTTCAATCATGCCACCAGCGTCAGCCATCACCACGCTCGAGGCGGCAGTTGTATCCGCCGTCGTCACACTACTACGACGTTGTAGCTGCACATTCC
TTTCCTGCTCTTCTTGCAGAGCGGCCTTCAACTTATTCAGTTGGTACGCCATATCAGCCTCACGACGTTTCTCGTCGAGGGCAGCGAGGTATTTTGGCCT
CTGAATCGTCATTCGAACCACGGCTTGAACACGAATGACCATCGCCCGCATGTTAACGTAACTATGACGCTTGACAAAGCCGCGCACATACCGCTGAATG
ATGACAGCGTAGTGGTTGCTCTTGACTTCTGCAGCTACCTTTCGACCTTGATAACCTCGCCAGTGGGCCTGCATCAAAATGAGGCCGTTCATAAATGTGT
TGTACCTTCGCATAGCAATCACACATCGGATAACTGATTGAAGCTTGATAATCGCAGCCAGTTGTCGGAGGTACTTGATACGCTGCGTGAAGCCAAGCAT
GACATTTTGCAAGTACGTCGCCTTCGCATCCAGAAATTTCTTACGACGATCTTCGAGCTCTTCAAGCACACCCAATTGGAAGTATACCCGGGTCTTACCC
ATCTGGTATTGCACTGGAGACTCTATTTTCAG