Description :
From Genome Similarity Track
Location :
Scaffold_20:22889- 24310
Sequence
1421 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGACTTGACCTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGA
TCCTTGCCCGTGAACTCCTTCAAATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGTCGTGGCTGTTGCTACCACTG
CTGACGAAGTGGATGGGCCATCCGGATCATCTGGGTCGAGCTCATCATGGGAGTTGTCTCCCTCCACGGATTCCATCTCCACGTCTCGTGCTCCATGTTC
GTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAA
GTGTCAGAAGAGCCTGTGGCCGTCTGGCCCGCTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGC
CGGATCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGCGGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCTCGGATCCT
CGCCCGCGCTTCCAGCATGGATGCCCGGTAGGGTCCTAAAGTCATGCGTCGTGGTTCGAACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTC
GAGGACGCAGCTTGGCTGATCCTCGGTGAGGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTTG
CGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACAATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGAC
TGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGC
AGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGATCTTCTTCCGACTCTGGAGCTT
GCATCTTCTTCCGCGTAGTCT