Description :
From Genome Similarity Track
Location :
Scaffold_60:228822- 231563
Sequence
2741 bases(100 bases per row)
GTACCGCTTAAGACGTCCAACATAGAACGTCGGGAGCATCGTCATTGACTTTGGCAGGTCGATGGTGTACGACACACCATGTCTGGCCAGGACTGTAAAT
GGTCCGATGAAGAGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGTAACCCTAAGCCCCCCACTTTAA
ATACACTTAAGTTTCCTCTTCCATGTTTGTCGGAGTACTCCTTTTGTTTATCCTGGGCCGCTGCCATGGCATCGCGGACTCTGCTGACAACGCTCAGCTT
AGTATTCATAAACGATTCCACTTGTCTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCAAGCCTCCCCCCACTTAGAATAG
AAGAGTCAGTGTCTCCTCAAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTT
GAGCGCAAACTTAACAACTGGAAGCTGCATCGATCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCT
GTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGAAAACAGCGTTTTCCAAAACGCTGCCGTGAACCGCGGGT
CTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAACAGTGACGGGAACCGG
AGCAAGATGTACCATCTTGCTCAGCCGACACACGAAGACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATC
GACTTCCAACAGTCAGCCGGGAAGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGTCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTCACGTATC
GGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGCCTGAGCGACCGACAGAAAGGTCTTCTTGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCGTGCGC
CTCCGCGAGGATGTCGAGCTTCAGATCCTCGTCATTGGATACGGCCACCCGTGGAGGTTTATTGGACTCCACCCGGTAATAGAGGAGGCCATCCTTCAGC
TCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCCGTGAGGAACTTGACGATAGGCGCGACAGCCTCAT
CGTCCCGATACGCCATGCGTATCCGATCATATAGTTCCGTTGTCACCCGTGTGATGTGGGCCAACACATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAG
CACGTTGAGCTTGTCCGGCTTGTATTCGACGCGGAGGTTGTACTCCGCGAGGAAGTACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTC
GCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACGAAGGGCCGGGAGCCCAGAAGGTGAACACGAAACTTCACAAAGGCATATTTCATTGCCAGGAGCT
CCTTGTCGTGGACAGGGTAATTACGTTCGGCGGCTTCGAGCTGCCTGGACTGGAACGAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCTGCAATAC
ACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATG
CTGTCAAAAGCATCCTAGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCATCTGAAGGAGGCCCGACAAGGGCTTAGCGAAGCTCGCGTACCCTTCACTGT
ATTTGTGAAGGTAGTTGGCCAAGCCGAACCACTTTCGAAGATCCTTTTGGGATCGGGACGTTGGCCATGCTGCTATGGCCTTGCCCTTGTCTGGGTCAGG
CCGAACGCCCACGTTGCTTACGAAGCAACCGAGAGCTTTAATCTCTGGTGACGCGAAAACGCTCTTGTCGATGTTTGCGTAGAGCTTGTTCTCTCGCATT
ACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGACCGTCTTTCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTA
CGAAGGTACGCAAAGGGCGGAACCGTTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCAT
GCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTC
CCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACT
TTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGAATTCGACTCCCGCACCATGCCTGCCTTCGTTTTCGCGGCGAAGAAGGCATCAAT
GACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCATGCCGTACGCCTCGATCCGGTGGG
AGTTGGGTCGGTGGATGTTTGTTCACCACATCCGCATACTC