Description :
From Genome Similarity Track
Location :
Scaffold_689:2288- 4137
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_689-snap-gene-0.7ATP-dependent RNA helicase DHX8

Sequence
1849 bases(100 bases per row)
ATGAAAGCTATCGCGGAGAACCAGGTGCTCGTCGTGATCGGCGAGACGGGATCGGGAAAAACCACGCAGATGACGCAATACATGGCTGAAATGGGGCTCA
CGTCCACGGGCATCATTGGGTGCACGCAGCCTCGTCGTGTCGCGGCATCATCGGTCGCGAAGCGTGTGGCGGAAGAATTTGGTTGTGAGCTTGGGCAGGA
AGTCGGGTACTCGATGCGTTTTGAGGACTGTACGTCGCCAGAGACCGTAATCAAGTACATGACCGAAGGTATGCTGCTGCGCGAGTATCTCGCCGACAAT
ACACTGTCCAAGTACAGCGCCTTGATGCTCGATGAAGCCCACGAGCGTACGATTAACACGGACGTGCTCTTCGGTCTTTTGAAAGACTTGGTGCGCAAGC
GCAAGGATTTGAAGATCATCGTGACGTCGGCAACTTTGGATGCCGAGAAATTCTCGCGCTATTTCTTTGATTGTCCGATTTTCACGATCCCAGGACGCAC
GTTCCCCGTCGAGATCCTGTACACGAAGGAACCCGAGCTAGACTACTTGGATGCGTCGTTGCTCTGCGTCATGCAGATCCACCTGTCGGAACCTGAGGGC
GATATCTTACTGTTCTTAACCGGTCAAGAAGAGATCGATACGGCGTGCGAGGTGCTCTATCAGCGCATCAAGTCTCTTCAGGAACGAGCACTAGCGCCGG
AGTTGATCATTCTTCCCGTGTATGGTGCCTTACCATCGGAGATGCAATCGAGAATCTTCGAGCCTGCCCCCAAGGGGTCCCGGAAGTGCGTTGTGGCGAC
CAACATTGCTGAAGCCTCGCTCACGATCGACGGTATCTACTACGTCGTGGATCCAGGCTTCTGCAAGCAGAACGCATTCAATTCCAAGATTGGCATGGAC
TCGCTCGTAGTCGTGCCGTGCTCGCAGGCTTCGGCACGACAGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACGGGACCAGGCAAGTGCTA
CCGTTTGTACACTGAAAATGCGTACAAGAACGAAATGTTGCCGACAACCGTTCCAGAAATTCAGCGCGCTAACTTGGGCTCCGTGGTGCTGCAGTTAAAG
GCGATGGGGATCAACGACCTCATGGGCTTTGATTTCATGGATCCGCCGCCGCAGCAAGCGCTAGTGATGGCGCTTGAGAATCTGTATGGACTTGGGGCGC
TAGATGATGAAGGGCTTCTGACCCGGCTGGGGAAGAAAATGGCCGAGTTCCCTGTCGAACCGAAGAATGCCAAGGTTTTGTTGACGTCGGTCGTGCTGGG
GTGTGCGGAAGAAGTACTGACGATCGTCGCGATGCTGTCGGTCGAGACGGTGTTTTTCCGTCCGAAGGAGAAACAGGCGCAAGCCGATCAGAAGAAAGCC
AAGTTCCATCAGCCTGAAGGCGACCATCTCACGCTCTTGGCCGTGTACGAAGCGTGGAAAAACTCCAAGTTTTCGAATCCGTGGTGCTTTGACAATTTCA
TTCAAGCGCGTGCGATTCGTCGTGCGCAGGACGTCCGGAAACAACTTTTATCGATTCTCGATCGGTACAAGATGGATGTCGTGTCCTGCGGCAAGAATTT
CAACAAAGTGCGGCGCGCGATCGTCGCGGGGTACTTTGCGAACACGGCCAAGAAGGACCCGCAGGAAGGGTACCGCACGATGGTCGAGGGCCAGCCCGTG
TACATCCACCCGTCGAGTGCTCTTTTCAACAAGAGCCCCGAGTGGGTCTTGTACCACGAGCTCGTGCTCACGACAAAGGAATACATGCGCAACATCATGA
CGATCGATCCAAAGTGGCTCGTGGAGCTTGCACCGGCATTTTTCAAGAA