Description :
From Genome Similarity Track
Location :
Scaffold_813:2288- 3537
Sequence
1249 bases(100 bases per row)
ACTCGACATGTCCAGTGAACATTACCACATGGCTTTATCCATNNNNNNNNNNACCCATGTCTTGCGATAGATCACTGATCCGACGCATAAGGTATACCAT
CAACCTAGTCAGCTCGTTCACCCTCCTGTGATCAATACACAGCCTTATAGCTTCTTCGTTTTTCTTTATGNNNNNNNNNNCACCCTCCTGGTTCACCCTC
CTGTAGTCAATACACAGCCTTATTTCTTCTTCATTTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCGAAGGGGTTGTCTCCATCCACATCTATATCAAAGACTACCCCACGTGCCGCAAGTGGCAGGGCATTACCTTTTCCAATCAGCAAATNNNN
NNNNNNATATGTCGCCGATATAGGATCATTGACTCAACACCGATGGTTCGGATCCGTATCTGTTTCACCAGCGGTGAAGAAATCGATCAACNNNNNNNNN
NCCCAACCGCGATGGTTTCGGATCAGTATCAGGTTCACCATCGGTGAAGACATCTATCAACTTCGATGACCCGGCCGTGATCGATTTGGATCTTGCGCCG
ATTTTTAAAGATCCGAACAAAGCGTTATCAATCACCCTTTGGTAAATCTGCGGAGCGTTTTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNATCCACGTTTTGTAATATTTCACTGATCAGAGGCATAGGGTATACAATCAACCTAGTTAGCTGGTTCACCCTTGCAATCAATACACA
GCCTTATGCCTTCTCCGTTTTTCTTGATGACCATGGTGATGTAGATGGTCGGATGATCTTGNNNNNNNNNNATCGCCACTGGAAATCTAACTGTTTTCTC
CTTCTGCAGGTGCGTCGGTCACAACCGCTTCGTAGTTCTAGACCAGTTGATCAGCCTGTTCTTGCAACTCACCATCTGTGATGGAGATCGTGTCTGGCTG
ATGGCTGGACCGTTTNNNNNNNNNNCTCACCGCTGGAAATCTCACTGTTTTTCTCCTTCCTCAGGTGCGTCGACCATAACCGCTTCGTGGTTCTCGACCA
GTTGATCGGCCTGTTNNNNNNNNNNTTATTACTTGCGTGGGCGTAACAA