Description :
From Genome Similarity Track
Location :
scaffold_22:22877- 24414
Transcript NameFunction/comments
g1174.t1 hypothetical protein PHYSODRAFT_495612

Sequence
1537 bases(100 bases per row)
GAAGACTGTGCATTCTACGCAGACTAGTTAGTGGTGTTACGGATGTAGTACGGCTCGTCCTGGAACTCCGCATCGCAGTAGGGGAACGCCGTATCGTCAT
CTGTCGACGTGAACAAGTTCTCTCCAGCGTGGATCATGACGTAGCAACCCGCCACGGAGCAGCCGATCAGCACCGCCGCCGACATTCCCTTGTCCAGAAT
AGACATCTTTCTCCAGAACACGCGCATGTAAATGATCACGGGCATCAGCATGCAGTTGACCGTGTGGGCCGTGGATCCAGTGAAGTCTTCAAGATCCAAG
AACTTGTCCTGCGCAGCCACAGCGACGATAACCATTACGATGATCATGGAGATACGAAGCAAGACGTAGCGGACAGAGTTCTTGGTGCCCTTGTACGGCT
CGCGAAGGTGTTCTTCCGTGATCTCCTCGGGACACTCGATGGCAGCGCGGAGGTGGGACATCCGGCCCTCGGACTTTTCAAGCAGACTGGAAGCCGACAC
GTGTCGGTCCTGGGGCGTCAAGACTTGGGCGTACGACTGCTTCTCCTGCAGTTCCAGGTCGTGCTCCACGGTCTCCATGTCTTGATCGGGGTTGAACCGC
ACAATGGGCGAAGTCTTGTGCATGCCCAACACCAAGCGCTCAGCGATGTAGAAAGCCGGCATCATCATGGTGGAGAAGGCGATGGAAATGTGAACCTGCA
TGAAGAGGTACGCCATCACGACTGCAGCCCGACTAGGAGTGAAGCCCAACGGAGCGGCACCAAGCGGGTTCGAGGTGCTCACGATCGAGTACAGCACGTT
ACCTGAGATCTGGCAGCCGCCAGCAGTGTAACCAGCCAAAGCGATGGCGAAGAAGAAGGCAGAGATCGTCAAAAGAGTGATGACCAGCACGCGAGGCATC
CGTTGCGGCTGCGAGTGCTCACGCTGGAGGTCAGGGATCACTGGAGCGGCGCCATACGCCAGAGCCAAGTTACCGAAGCACGTAAGAACCTGGTGAAGCG
ACACGTCCGGCGTCGGAATGGACGGGTGGCCGCGCATGTTGTACTGAAGAACTGCGACGGCGATGATATCAGCGATGGCGGTACCCATGCAGCCAGCGAA
GGCCATGCCGGAGCTCTCCTTAAGCGTCGGGATCAAGCAGACAGGGATGACCAGCAGAGCCATGAAGACGATCCAGAACGTCTGACTGAAGGTGTCCGGG
AACAGCACGTCCAACAGCGTGCTACCCAGTACCAAGAAGGCGATCGGCACCATGATGCACACGCCCATCTGGGAGAGGACGGAGAAGAAGCGGCCCCACC
TGCCCCAAGCCCACTCGCCCAGGTCTCCGTACGTCTTGACGGACGATGGAGCAGCCAGCATGGCCCTGGACAACGCCACAGAAGCGTACGTGTTGGCGAA
CATCATGAAGGCAAGCGCAAGCGTGGCGTAAATGGGTCCAGCACGGGCGAAGTTAGAGGGCATGCCGAGGGAACCGATACCCAAGACGCAGCAGAAGAGG
TTGAACGAAGCCTTGGCATCCTCCAGCGTGAAGAAGG