Description :
From Genome Similarity Track
Location :
scaffold_132:22877- 33545
Transcript NameFunction/comments
g4282.t1hypothetical protein
g4283.t1 hypothetical protein PHYSODRAFT_284634
g4284.t1 hypothetical protein PHYSODRAFT_471024

Sequence
10668 bases(100 bases per row)
GTCTACAAAAACGGCATCCATCCGATGTACATCTGCGCGAGATTTTCGTGCGATGTGGCCTCGTGGATGAGTTTATCAACTTGGCCTTGAACTGAGAGTG
GCAACGTTTCGATTTCCGGCAAGATACTGCGGTGCGTCGTCGTCACAAGCGGGCGGATGGCGTCACCCAGGTTGTAGATGCCACGCAGTCGACCGTCGAT
GGACTTCAACACAAGACGAATCTCTTGCTTGCTGCGCTCACTTGAGAGCTCGGCAGGAGTTTTACCGGAGCTAGCACTGCTTTGTGTAGCTTTGCCACGA
CGACCCCATTCGACGAGAGGGTCGTGAATGAAGGATTCTAGCACGCTGCGCAGTGTCGCCTTGTTTTCTCGCAGCAATTGTATTGTCACCTCGCTTACAC
GACGGAAAACACCCTCGTACCCCGTGATCCCAAAGGCATCAATGATGTTGGGGGTCAAACGGAACGGCACGATTTCAGGCTTGTTCAGTTTGAGGCCTTT
GTCGAACAGACAGTCAAAGTCTACATGCACGCACTCGCCATTGGTGCAGTCAATCAAAATGTTTTCTCCGTGACGATCGCCCAGGCCGACAATGTGCCCC
ACCATGGACCACACAGCAGCTGACCGCGTGAACATGAGTCGAGCCTCGAACCATGCAGTCGGATCGGCGAAATTATTGTAGAACCACTGGTGAAATCTAG
GCGTGAAGACAGGCATCGATAGCACCTTTCGGCGGTAATACCGTGCCATGGCTGGAGGGTCATTGGCATACTTCTTCTGCATGTTCATATATCGCTCCTT
GATGTCACTTGTCAGCCGGACAGGCTGTATATACCCACGCTCTGTCTTGTGAATCTGCCCGATAAGCTGTCGCATCGTCTTCGTGTACCGAACCCATTCC
ATCAGTCCACTTTCTTCATTCAGACAGACCACGGCATATGTGCGCAGTCGCAATTTGCGCTTGCGGCCTTCTCTGTCTTTCTGAAGCAATTTGTTGATCA
TCGAATTAAACTCCATCATACGCGCGTCCTTGCGTAGATCGCCAGTCTTCTCACGCTTGCACAAGAAGGGGTATAACTGACCATCGGTTCCCAGAACTTC
GATGCGCTTTGGCTTTTCCTTGGTCATCATCACATCCGCCTTATCACTAAAAGCTTTAATGTAGATCTGCGCGTTTGCCGAAAAGGCAACATGATGTTCA
TCACGAGGGGCAAGTCCAGATGACGGCAGGATAGTGGTCAGTGCTGCCTGAGTCGGAACTAGAATTCTAGTCCGAATCCGAGTCAGGCGAATGTGAATCT
TGCGCTGACTATTTCCAGGATCATGTGCAGCGAGGCTGATAAGTTCCTCAGCCATTTTCACCCCCTCGGAAAAGCTGTCTGCAATCTCTTTTAGACCTTG
CGACAAAAGCTGCTGCTGTGCACTTGAAACAACCTCACGTGCACGATTTCGGCGTTGGGAGTTCAATGATCGTGAGAGACCGAGCAGGGACCACATTGCT
TGCGTCGGGTAAGCCAAGAGCACTCGAACCATAATTTTCTTGACACCATCGACCACAACTGGATTGGGATGGCAAATGCGTGATGTTACTTGAGGAAAGC
ACATCAGCCATTCATATGCTGGCAACGACTCGGTGGCTTCATCGACAACTTTAGTGATGTCATCAAAAACCTTCTTCTCATTAGTGGACTGACTCATGCC
AATCTCAATCTGCTTCAGAGCCTTGTTCGCTTTGTTGCTTGACCGTCCACTGTTGGTTCCGTATAGCACTTCACCAAACTCGAACCATAGCGTTAACAAT
CGTGGAAGTGACTGAAACACGAACTTTGTTCCGTGTAACAGAGATAGCGCATAGTTTTTCATCAAATTGATCAGGTGGGTGTGAAACACCGAATCGACCA
AAAGGCCAGCAGCTTCGTCGCTACTCAATGATCCGCTGAGAGCATCGGGGTGGCTCACGCTCAGCAAGTACTCGTAATACTTGGCCAGGTAAAAGTATCC
TTTTTCCCACGTCGGATCAAAATGAATAACTGCTTGGTATCGCTCGATCACCTTTTTACCTTGACGCTGCCCCGACTTCTGCATCCAGTTAGTCGCCAAA
AGCAGGTTCTTGGCGCAAAAGTGGGGATCTTCGACATCAAAGTCAAGCGTAGATGCGTCAATATCGACTGGTTCAAGAATTTGGAGCGCCTCATACATTC
GATCCTGGCTCACCAGCAGCTTGGCCTTCTCTATCAGTGCATACTGATTATCCATTGACTGTGCATGCATCGCCGCACTGGTGGCAGTACGAATAAACCC
TTCTTTTCGGGCTAACTTAGCGTACAGCAACCAATTTTCTGATACTTCGTTTCGAAGCCCTGCCTCGTGCAAAATCACTCGTCGGAGCGCAAGGATCGGA
TCACGGTATTTCAGCTGTGTTGCCATCGCATCATACCGTACTTTCCATGGGGTCTGCTTTTTCCAGAGAGCACTGCGTCGACCAAAGTCATCATACTCCT
TCACTTTCTGCAAAAATATAAACCCTTGCTCTGCCTCGTGCAGAAAATGAAGATCTTGCAGCAGTGGGTATGCACGTTGATATGACTCAGCTGACGCCGC
TGCTAAAGGCCCCATCACCTCCAATCGTGCTGCTCTTAAATGGCGCTGGAATTCTTCTTGTTGGCCACCATGCAGACTATGCAGTACGCGAACCATCATC
AGCTGCGATACATCAAATCCCTTTAACAGAGTGGTCGGCGCGTCGCCTGAGGAGTTTCCCGATGAACGCAGTAGTGGGCTCTGTTTTTCCGCACTCAGGA
GATCTGCCAGTAACTCCCATCGAGATAACCGCCACGAGCACTCAAGCGCATATGGATACATCGTAGCCATCATAAGTGGTTCTTGAGTTACTATCCCATT
GATATGTTGTAACGCGCTCTCGAGACGCCCAAGTTGGATAAGACAGCCGATCATTCCGCCATATAACTCGGGTTTTATCACATCAGGGTCTTTGAGTGCG
TTTTCAGCATCCAAAATCTGCGGAGGAGGCTGCATCGTCGCGAGTTGACTGTAAAGTGGTCTGCTAGGAGGCATCGATCTGGATGACAATGCAGACTGGA
TCTCTTGAATTGCTTGCTCATAACACGCCAGCGCATCTTCCCACTGTGCAAGCTGCTCATGATCGACAATTTGATGCATTAAATCAGTGAGACTCAGTCC
CTCGTTTTGAACTTCTCCTTGCATGTCTGGTCCAGCATCGCTTTGTCGGTATGTTTCGTACAAACGACGCAAGGTAGCCAAACCGATCAACGCATCGGGT
TCGTCCACACTTTTGTATAGCTGTTGGAGATAAATAGCATTATTCGAAACCAATGAGAGGCGAATCGGGCCGGTCACTTCAACATTGGTACTTCTTGCTT
CTGTCGCTTGAAACTCTTCCTGTCGTAAATGGACTTCAAAGTATTGGATTGCCCGTGCATACGCTTTGATTTGGAATGCCGCGTTCGAAAGTGATCGGCT
AGGAATGCCTTTCATAAACTCTTCCAGGTACTCCTTTTCATGGTCATCGATCTCAGAGGTCATGTCGCTCCGAGCAGAAGCCGACGTTTGCCGACTTGTA
GCACTGGCACTTAGAGTAAGGCGTTTCTTTTCACTAGTCCAAATCCACTCGTTCAGCTCATCGAATGTCGAAAAAATGGTTTGGGAGCACTGATCATGTC
GCCGAAAAAAGTCGCCAACGGATGTTTCAGGCGCACCGTCAGTATCCGTAAGTGAATCGTTCATGCGCTCTGACTCAGGAGGAGCCATTAAAACATCATC
CATCAAAACTCCGCAATCTTGATCGTCCAAAACTGCCATGACTTCTTTCTTAAGCTCCTCCCCTACTTCGGATCGTCCGGACCGAAGTACATTTTGTATC
AGATAAGGCAGTAAAAATCGGGATACCTGAGGGCATGTTGGAAGTGCAGTTTTGCAAGCCACGAAAATCTTCCTCTCGGGCAGTTGAGAAAGATTAATCA
ATCGCCGACACCACATCAATATCCATTCCTCATATGATGTCCCATAGTTTTCGTAAAACGAAATGTCGTCGAGTGGTAGATGCTGGTTCCGATCCGCGCT
TGCAGATGACTGCTGATCAGATCCACTATTTCCATTGCGGCGTGAAGATCGACTGCCTAACACGGTATAGTTTGTTGACCAGTAAGGTTCAACAAACTGT
AGAACATCTTTCCGTTCAAATCTTCTTTTCATCCACTCAGGCATTGGGGCGCTGGGGTCTTGCCTTGCCTTGTAGGACGAACCGATATTGCTTGTCACCA
AACTTTGCCCGCTGTGTTGCGGATCCGCCGTCAGTTCGGCCAGAAATTTCAGTAATTCTTGAATCGCAAATCCTAATGAGTCCGTGTTCTCGGGTGCTGC
CCGCAGTTCCTCCACCAACAATGTCTCAATCAGCACACAAGCTAAATCCTTCGTCGAATACTCGATCTTTTGGAATTTCTTTTCTTTTGCGACAGCTCCT
CCTTGGGGCCCAGATGTGTAAAACATGTTCAACGGAACGCGGGCACCATCGATCGCACCAAGCGCACCCAGACATCGAGCGCAAAGTAGCTTGATAGGTT
CATGGCTCTCCGTGCGTGAAAGTTTCAAAATACACTGCACCACGCTAGCAACCGATCCGTCAATAAATATGTCTCCTTCGTTCTGCATTAGCGCCTCTAA
TTCGGCACCACGCACAACCAAACAACGCAGCAGCTGCGTTAACGCCATTTCGCGAACTGCTATATCACGGTCGTTGACGTATTCCGATAGATTCATCAGA
TAATCACGTAAAGGTCGGCATCTAGGGTCTCCCTCGTCCTCGTAAAGAACAGCGTAAATTTCATCGAGTTCTGGGATGGATGGTAGCAGCGGAATCTTCG
GGAAATGTGGTTTCAATTCAGCTCCCTTCTCGATAAACAAGTAGCGTAAAATCCCCACAGCCGCTGCCATGCATCTCGTTTCAGCTTCACTTCGATTGTC
TGGCGAGCCGACTTGTCCAGGACCATCGTGCGTAAAATTCTCCAAAGATTCGACATTCCAGCATTGGCTATCAACAACAGACCCGTCTTCAATCAAAATT
GCTGAGGTTTCTTGACCGAGGCAGGGGAGCAAGCTGACAACGATGGAGCTTAAGTTCGCCTCTAACGCTTTTGTCGACAGCATCCGCAGGAAATTGCCCC
ACGCGTGAATGGCATGCTCCTGCACTTCCAGTTCCGTGAGTCCCACTTTAAGAGTTGCCATCACCTTCGGAACAAAGGGGTCGACGGATCCATTATTCTG
CGTGCTACTCGGGTCTGCTGAAGAACTGCTATAGAGTTCCAGCAAGCAGTCAATACTCTTGACCGCGCGAATCTTCACAGAGGCCAGGTTTCTGCCACTG
ATTTTATTGCCTAGATCTGTCATAATAGCCAAAAAATACTGGCGGGGCATGCATCCATCCCCAGGCTGTAGGCTCGCAACTTGCTCGATCGTTTCCACAC
CCCGGGAAGCTTCATTTAACTTGGCTGCCACTTCGCGCATCGCTCTCTTAGCTATTCGAGACTGAGGCCCACCAAGCTCCCACGCCATTAAATTCGTTAG
TCTCAACGGAGCGTGTGTAAATAAATCACGCACGGCAGTGTTTTCAGGCAGGAATTTAAACAAAAACTCCCATTCGGCAAACCGGGTATTGTTCGAGACT
GTCTGCACTTGGCGAATGAGCATATCTCTAAGCACATACTCGATATGATTCAGCAGAAGGTTCGAGATATTAATCAGTTCTTCGTCAGCGTCATTACCAT
GATCAGCCATTGTGATATCTCCCCTGGTCTCATTGAACTCAGCGACATACGCACGTAACATTCGCTCGTTTTGCTGGACAACGTATTTTGGAAGGACATA
GGGAGCACTAGCCTTCAAGAAAACTATCGTATCTACTTTTCCGTTCATGAACGTGCGGAGAAACAACTGGAGGGTCTTAGTTTCCACCAGTTCATCAATA
AGAGAAAAATAAAGTAGCTCAGGGAATTCAGTGCACAACTGTGTCCACGACACTCGGTGGTGTGCCGTGATACGGCAAATTTGGTCGTAAGCCATTGCTG
CGTAGCGCGAGCGATTTGCAACCATGAATCGGTTCCAAAGAGATACCAAGCGTAAAAGTATCCACATGCAATTATCCCCGCGATCACCTTGCGCCGGGTC
GCATTCACAACCAATTGAACCCGACACCTGCATCATAGCTGCGATAACACTGGCATCGTTACTCAATTCTGCCACCGTTATACGAGCCTCCAGCCGCTCC
ATCAGCCCATCGAGTCCGTCCTTTGCTGGATCAATCATCGCATCAAGAAGGCGGGGTTGGTGATAAACCGATTCCAGAACTGCTTGTCGGACGAGCTCCG
AGCGATGGTCAAAGCACGTTAGAAGGCGTTCCACGAATTTCATAGCAGTCTCGTCATTTCCATAATCAACCTCACAGTGCTCAAACACACTCGACAGCGC
ATTGATTTTGACCAGTTGCATATTTTCGATGGCAGCACCTGTTTCGTCACAGATTATCGGCTCGAACAACGCAAGTGGAATTGGCATCGCTTGACGGCCA
GTAGATACCTTTCGACATTGACAACTCTTCAATCGGCAATGCATAGGGGGGTCTTGTATGGTGCTGAAATTATTTTCTCCTTCGGCGCATGTTTGACCAA
ACGCTGTTGCGCAAAGCACAGCCCCGCATGCTTGTGTTATTGCCGACGAAATCGGTTCCGACGCTGTCCGTTGAATCTTTCCACTAAAAGCTTCCATGAT
GCAAGTAGTCATCTTTTTCGGGGACGTTAATGATCCCGACACGACAAAGAAAGCAAGAAGGGGTGTCATAGCAAGATAGGTGCACACGGCCACGTCGAGT
GACGTTTCTTGCAAAATCGCTCGGTACGCAACCTTCCATGGTAACGCATTCCGCCATGAATCTTCATCGGTAATGTTTAGAGCCACAGGACGGGACCACA
CAAAGTATACCAAGAATGGACCGCGGAGCGCCACAGACTTTCGGAAAAGAACATCAAGAACGGAGTCTGCGCTTCGGAGGTAATCGTATGATACGTCGTC
GGGTCTCTCCAATGGAGCCAAGTCGTGGCACTTAGAGTGGCGTTGGTACAGTTCTAACAATTCCAGATACTCCCAACAGTCTGGTACTGTAAAAGACTTA
TCCCGTCCAACACTTCGTGCAAAGAGCCCCTTAGTCTCTACACTCTCCACAACTTTGGTCAGCAAGTTACGATACTTCTCGAGCTCGTGATCATCGAAAT
ACCGCAGCAAGATTATCCATAGATCAACGTATTCACTTGTGAGGGAGGCGAGCGATGGTGCGTTAGTGTTCACAACCAAATCGACGCGCTGCAGGAGTGA
TCGAAATACGGCAAAACTTTCTAGCCGAACAAAGGAAACAATGTAGCGACGAAGAGGCAAGATCACCCGCAAAACAGTGGAAATCCCCACTATACTCTTC
CGGTCGCTACCATTCCCGATAGAGATGAGGTCAAGTATCCACCGACCCAGCCTTTCGTGTAACTGGATGTCGTTCTCTCGACGCAACCGTAGAGATAGAT
TCTCTCTGCCCACAGATAAATCACTTCGCTTTCGCTTCCTTGCTCTGGGGTATTGACTTGAGCTCGCCGCATTCTTTCCATTGTTAACCAACTCTTTTGA
TATAAAACGGATCACCTTTATCAGCATTTCCTTTGCTGATAGCATGCGGTGAATGCCAGCAATTATCCGTGATACCACTGCAGGATTCGAGACTTTTAGA
TCAAAGTGCTCCAACAAATCCATATATAACGAAGCGGGGGATGAAGTGTTGGACTGGCAAGTGTACGCGCCCAGAATCGAAAGCACGGATATCCAAATAA
TCTCCACGCTGCCTTTGCTTTCACGACTAGCCCCGCGACCTAGGTCCATATTTGCAGATATCCACAACTCAAAAGAAGGCCATAGGGCATCCGTAGCAAA
CTTAGAGAGTCGGGGGAAAAGCTCGCCGACTAACTCGAGGATGGCTGCACAGGCTTTCAGTATCCGTGGATTAGCTTCGTGAAGATCTCTGGCCTTTAGG
AACATCAGCACCAAGCGAACAAATCGTCTTTCTGTAGAGACGCCGGCCTGCAGCATCGTGTGCAGCAATCGAAGTGTGCTTCTAGTAATTTCACTCGCGT
CTAGGCTTGAAACAGCGCCATTCACATACGCTCCATCGGCGCATTTTACGAGCTCCTCGTTTTTAACGACACAAAGTTCCACAAGTTGGCATAGCCTGTC
TAAAGACTGATCTCCTTCGAGTATCACGTTATGCTCACGAATGATCGACTCGGCAAGAATGACCACAGATTGCCGCAGCGCCACCACCGCTCTGTACGAG
CCAACAGAAATAGATGGCAGCATCCGCTTCAGCTGCTCTCTGCGTTCATAAAGCTGGTTCAAATCTGTAATTGGCATACACCCACACAACGCAACATTGC
TTTTCGCTCCAAGTGGTCCATCCGCATCCTGGTACACGTGAATCGCAGTATCCAGATAGCACGCGATATTAGCTCCACCAGGCAAAAGATCCATCGAATC
TCTGTCCTTCAAAGACTCCTCCAGCAAGAAGCAGTCCTCTAGTAGCTGCACAGTATCACGGAAGAAGTGAATAAAGCCATACACGTCGTTCTTCTGCAGA
AACAAAACCATCTGCAACGTCACGCCGCGAACGTCTCTCTGTGCTTCTCTCAGTGTCTCGTTCGTGTAGAAAGACACCATGTAAAACAGCATCGTGGCCA
TCGTCGGGTAGGACGGAAACCCCGAGGCCACCGGGTTGTTCCCGTGCACCACGCCAGTGTCGTTCTCCATGAAAAGCGTCATCGAATGTGGACACGCTCC
ACCGCCCAGTAGTAGCGTAAGCAGCTGGCACAGATCCTGCAGCACAGGAATCGCCTTGTCGGTCGCCAGAGTCGCCACAGGACGCATGAGCTTGGGAAGA
AGTTTGCGCAGCTTGGTCAGCATCGTTTTGCAGCGTCTGATGGCGGCAGGAGCACTCGAGTCGTATTCACGGTCGTCATGTTGGCGCTGGTGGGCGCGCA
CGATCCGCAGCAAGCTGTCCACATCGCTCTTCTCGGCCTCGTCGGCCCCTGGGCGCTCAGCCATCGGCGCATTCACTCTGTATGCTGTTCAATATGCTGC
AGTTGCTCTCACTTAAGTACGTATGGGTTCAACTTGGAAATATTGATGTGGTGCACACAGCAATCCCCTAAGCCAAACAATTCAAGCGCTTCACTCCGAT
CGCACGCTCAGTAGACCAGGAACAGCATGGCGACGAAGGGTGTGTGGCAGCTCAAGCAGGTGACGATCCGTTACTGCCAGCACGGCGGCAGCAGTCGCTA
TGTGCAGCAGCTTCTGAGCGACGAGCGCTTCCTCAAGTTCGTGGAGGAGAACCCACAGGTGCAGTTCGACACGGAGCTCAAGGGCGCTCGCCACCCCATC
CTGATCGGAGACTACGGTGTGTTCAGGCTCGGCGTCATTTGCTTGAGATATTGGAGATCAATTTACTAAACATTTTTTTACGGTTTATTGCAGTGACAAA
CCAGCGCAAGGTGGCTGACATCAAGAACCAGGACATCCCCTTCATCCTGAAGCAGGTGGGAAACAATTGGCTTAATGTCTTGTTTTAGCGATTATTTTGC
TGATGATGTTGCATGCAAACTTGTTTGTGTCGTGGTTGTGCAGTTGGAGCGCCTTCGTAACTCTAGCGGCCGTAAGATGACGCCTATCAAGAAGCCGGTC
TACTCGAAGCGTCCGACCATCCAGGGCATCTGGCAGCCGGACCTAGACTTCCCGGAGTTCAAAATCACTGACCGCACGTAGACGTCGATGCAACTACTGT
AGTTAGGAGAGAGGCAACTTCAGGTGCTCAAGCTTCGTCGTTCCTGTGTCGTCAAGTGTAGATCGCAGCACTTTATGCAGGGGTGAATCGCACTTGTATA
CACCGTGCGATGGCTGCAATGACGACTGCAATTACACTACGGAGGGGGCTCTCCTCAACAAGTGAAGCATCAAATATATTCTTTCAGCAGCCGCCGAGAG
ACAGGAAGAGACGTCTGCCATCTCGTCTCCTTCCTCCCTTCTCATCTAACTGTTTTGAACCACAAGCCTGCAGACGTCAAGAAGCTGCAGACCGCGGCAA
CTAAAAGTTACAGCACCTGGGGGCCTGCCGTCTTAGAAACCGTGCAGCACCACCTGGGCGTCCGTGCAGATCTCCTGGTCCAGCAGGAACTCACGGATGT
TCGTTCGCTGGTCACCCGACAGCTGAATGATCTCGCCCAGCTCGTCGTCCTTCACGATGGCGCCGTTGCAGCTGAAGTTCTTCTTGAAAGCCTTGAGGAT
ACGCTTTACGTCCAGGTCATCGGCCAGGCCTTGCACAGTCGTCAGACACTTGCGGCCGTTACGCTGCTGCACACGCACGTGGACCTTGCCTCCGCCGATG
CTCGAGTCGTCCTTGGCGTCCGCAAAAGCGTCTGTGGAGCAAGAAATATACGTCAGAATATCGCTCAGCACCTATCTGACAGCACTGCGCATCCAGTATC
GCCTTGCTGTAGCTATAGGAACTCACCGAAGGTCTGGAAGTTCTGGATGTCCGCCATATTCGCTACGT