Description :
From Genome Similarity Track
Location :
Scaffold_127:22872- 24243
Transcript NameFunction/comments
Aphas_H257_17962Hypothetical protein

Sequence
1371 bases(100 bases per row)
GACCGCAATGCCCTCGGCCCGATCCGATTCTTCCACGCGCAGCTCATCTCGATCGAGCTGGTTGTGCACGGCAGCCTCACGACTTTGTACTTTGTCAAAC
CTGCCGATGCCATGTACTTTGACGAGTTGCTCCAGAACGAGCTGCTAGATGCGATGGACATTGGCAGCGACAAGGCCATGGAAGTGCTGCTCTCTGAAAC
GGCCAAGTGCGTGCCATATCGTATCTATCAGCGATGCATGCATGGCATACACGAAATGGACTGATGTTGTGTAGGAGCATTGAAGAAGAGCTCAAAGTGA
TCAAACACCTTCGGCGCCATGCCGTGTATGCGTTTCTCGCGCGGTGGCAGACGGACCTGCGCAAGAGACTGCTAAGCTTGTGCTTTTACATCAACTTTGT
GATGCTGTTGCTGCTGCGGTGGGACCAACCGGGCTCATATTTGTTTCTCCAAGTACTCGGCGCCGTCTACTTAGCTGGGTCGCTCGTCCTCCTCGGGTTC
TACGTGACCAAACAGTTCAACTTTAACTATTGCAAACAGCAACTTTCCCTCACAAAGCTGCACTTTCGATCGCCCAAAGCTATCAACGACCGCGTGTGGG
ACGCGTGGCAAGGCCCTATCCAGTGCTTTGGTTCGTACACCCTCGATATATATATATATATATTATATATGACCAAGTTCACCCTTATTATGAGACTTTG
AAAAATACCAATGTCTAGTTTCCAAAGACGAACGACTACTTCATGATATGTATGATATATTTCTCCACTATATTTCATTTTTTATATTTTTTAAATAGAA
AATGGTTGTGTATGCTCGTACCCACCCAACCACATTCTTGTGATATATAATATTGATATATTGTTTACCCAACCACTTTCTTGTGATTTATAATTATTTG
ATATATTGTTTACCCAACCACATTCTTGTGATATATAATATATTGTTTGTACATATTTTTTTATAGAAATCATTGCGTGGACCGTGTCGCTGGTGGTATA
TGTGAATGGATGGGACACGTACGGAAGCGTGACATGCTGCTCGGTGGCGGCGGCCGCGCTCGTCCTTTCGACCCTCCGCGCCGTCCGGGAAGTGGCCAGC
GTGTCTCGGTTCTCCGTCAACTCCGAGTCCTCGTATGACGAAATGAAGGTCAAGCTGGGGAATCGCATGCTCAAGACCAAGTTTCGATTCTGGTACAGCG
TGATATACGACACTCTGTTTTCCGAAAGCGTGCTGGCTTTTCTGGCGTACTCGACGTGTGGGTTCCTCGGGCTCATTGCGACCGAGAACCGATACTTGTA
CTATGGCTTTCCCCTGCTCGACCTCGTGGCTATCAACGCCGGGCTGCGATTTGTCGTACGTCGTTGCTGGC