Description :
From Genome Similarity Track
Location :
scaffold_775:2287- 6315
Transcript NameFunction/comments
Pl_102470PREDICTED: hypothetical protein isoform 2
Pl_102471conserved hypothetical protein

Sequence
4028 bases(100 bases per row)
AAAGATCTCGTGCCATGAGTGGGAAGAACATGATCACACTTGAGGAAGGTTGGGATCAGGAGATCAAGCCCAAGGCCATTGACGTGCTGCTGGACATCCT
GGACAAGGGCTTTGAACAGGTGAAGGTGTCGCCCTTCCCGCCCAGCACCTTCATGCCCATCTACACGACGTGCTACAACATGTGCACGCAACGCTCGCCA
TACAACTTCTCAGAGCAGCTCTACGACCGCCACGGCCAGACTTTTGACACGTATCTGGAGGAGAAGGTGCTGCCCAGTCTGGAGCAGGCACATGATGAGT
TCTTCCTGCAGGAGCTCGTCAAGCGTTGGACTAATCACAAGCTCATGATGAAGTGGATGACGCGCTTCTTCATGTATCTGGATCGCTATTACGTCAAGCA
TCACTCACTCCCTACACTGGATGATGCCGGTCTGCAAAGTTTTGACCGCATGGTCTTTCAGAAGGTCAAGGTGCGCGTCAAAGATGCTATGATCGAACTC
ATTGAGAAGGAACGCAACGGAGAGATCATTGACACGACGCTCATGCGCAACTGTGTCGAGATCTTTGAGGTCATGGGCATGAAGTCTCTTGATGTCTACC
AGAGCTGTCTGGAGGCGGATCTTGTGACTACTAGTGCCACGTACTATGAACGCAAGTCCAAGGGTTGGCTCAGTGAAGACTCGACGCCTGTCTACCTCCA
GAAGGTTGATGAGGCCCTGCAGAGCGAACGCAGTCGTGTGAACACATACTTGCACAAGTCGACGGAGCCGAAACTGGTGAAGAAGCTGGAGAGTGTACTA
CTTGAAGCGGCACAGAAGGAGCTCATTGAAAGAGAGAACTCGGGTGTCATTGCATTGTTGAAGAACGACAAGCTTGAGGACTTGGCGCGGATGTACCGCC
TGTTTGCTCGGCTAAAGAACGGACTTGAGCCGATTGCAGACCTGGTGCAGCAACACATTACAGCTGTGGGTAATGATATTGTGGCCAAGCGCGCTAATGC
TGTCGCCTCGGGAAATATTCGCGATCCTAGCTCGGACCCTACTTTCATTAAGGATATTCTTGCCATCCACGATAAGTTCCGTAGCATTGTGAACGAGCAG
TTCGCGGGTAACTCACTGTTCCAGAAGGCTCTGAAGGAAGCTTTTGTTGAGTTCGTTAACAAGGATGTTGGTCCAGACAGCTCGGCCAAGCTGATGAGTA
CGTTCTGCGACCGTATCCTCAAGACTGGCGGTGAGAAGCTTAGCGATGAGCAGGTGGAGGACTACCTGGAGAAGGTGGTATTCGTTTTCTCGTACCTCAC
GGACAAGGATCTGTTTGCTGAGATCTACCGCAATCAACTCGCTAAGCGTCTCCTAAATCAACGGTCTGCTTCTGCTGATGCCGAAGTGCTTATGATTGGT
AAGCTGAAGTTGCGATGCGGTGCGCAGTTCACGGGTAAGATGGAAGGTATGATGAACGATTTGGCCATCGGCAGTGACCATCACCAAGAGTTTGAAGGTT
TCTTGAAGAAACAGCGTGAGAGCGATTCGAACGAGGCTGCTCTGAACCTTGAATTCAGCGTGCAGGTACTGACGACTGGCTACTGGCCGTCGTACCGCAT
TCTGGAGGTTACGATGCCACCGCTCATGGTCCGCTGCATGAACCTCTTCAAGGTGTACTACGACTCGAAAACTAGTCACCGTCGGTTGCAGTGGGTGCAC
TCGCTCGGTAACGCTACGATTCGTGCCAACTTCCCCAAAAAGAAATGGTATGATTTGCAGGTGACAACACTTCAAGCTGTGGCACTGCTGCTGTTCAACG
AAGGAGAGGGTGCTCTTTCGTTTGAGGCTGTGCGCGAGTCGTTGAACCTTACTGTTGATGTGGTAAAGCGTATTATGCATTCACTGTCATGCGGTAAGTA
CAAACTGCTTACGAAGACGCCTGCTGGTAAGACTATCTCGACTAGCGATCAGTTCGCCGTGAACCGTGCATTTGCTTCGCCGATGCGTAAGCTACGTATC
CCGATGGCTTCTCTCGAGGAAAGCCACAGCCAAAAGAACGTGGAGGAGGACCGCAGCATAGCTATAGAAGCCGCGATTGTGCGTATCATGAAAGCACGCA
AAACTCTTCAACACCAGCAGCTTATTTCGGAGGTGTTGAGCCAGCTGGCATTCTTCAAGCCAAATCTGAAGGTCATCAAGCGCCGTATTGAGGCTCTCAT
CGACCGTGAGTACCTCGAGCGCGACCCCGATCAAGCCAACACGTATCGCTACCTCGCATAAGCTACTGCCAAATTGATGGTTTCCCGTCTGGTGCAATGA
CGAACAGGCTTTGGGTGATTTATTGCGCAATACAGGTGTCGTTGGTCATATCATTATTCTTGTTGCAGCTCTCTTAATTTTTGCAAGCGCTGATCACGAT
ATATGGTAGGGACAACGGGAGTAATTGATACGTCTAATGAAAGTGACCGGCTGCTTGTATTACAGTGTGGAAATGCATCTACTTCTTGAAGAACCGGTTG
AGCGCTGTGGGTGCACTCTCGGCCTTTTCGTTCCACTCGCGCTGCTGTTCCTGCCGTTCTTGGCGTTTCTGCTTGTTAGCCAGCTGCTCCCGGAACTGTT
GCTTCTGTGCATCGACGACGTTCTGCTGCTTCTTGCGCAGTCGCCGCGACGGACGGTTCTTGCCACGCATTTTCTTCTTGGGCTTCTTGGCGCTACCGTC
ACCGTTGGCACGCTGCATCTGGTAAATCTTCTTCTCCTGCTCCTCGGCCGGGTCCATGTCCACACGACCGATGGCGTTCGGGTCTAATGTGATCATTTCC
GGACGAATCTTCTCCAGCAACGAGCGCACCTCAGACTCGTCACGCTGCTTGTGGTTCTCGTACGGGTTCGCCTCGTACGTGTCGAAGTTGGGCTCACCAG
AACCTGGAATCACTATAGAGTTGAAACCTGTAGCGTGGCCAACACCTAGCACGTCTTCGAATGGGCGGAACGCAAGCGAGTTGATCATTGATCCTGGAAT
TTGGTACGTCATGTATGGCCGGATGGGTGAGCCCGAAGAGAAGGTGCTCTTGAGCACGTGGACATTCGGACCGAAACCCACTGCCACAAGTCCACGCTGA
CTCACACTCATAGTGTTGGCAGCTGCCGTCAGATAGTAGCTGTTCAATTCCTGGTACTTGCGTAAATCAAACACCTTCACCTTTCTGTCTGCACCAGCGG
TAACAAGATACTTTCCGCTGTTGTCAATGCCGATTGAGCGAACTGCAACAATAAACACAATCCATATGTAAGCCGGATGCATATCAACACAACAAAATAG
CGCAACGTACTCGGTCCCTGGTGGCACTGCATCTTGACGACAGCATCCGACATGTTCGGTGTCCACAGCGTCACAATTCCGCTCGCGTGACCAAGGTTCA
CAACAGCGTTCCACGGGTTCAACGCCATAGTATCACACAGCCCCTGTTTGGTGCGGTGTGTGGACACCTGCTTTCCTTCCGTCACATCATGGTATGTCAA
CAGACCATTACCACTCACAGTCGACAGCAAGAAGTGGTAAGGCAAAAACTCCATTTTCCGTGGCTCTGGGATTGTGCGGATGCAATGTGCTTCAGCACCA
GTGTTGTCATATATGTACACGTGCTTCTTCTGTGCCGTAGCAAACAGTGAGTCGTTGTGCAAGAAGCTGATGTCGCGCACAAGGTCGTTGGCCTGAAACT
CGCACGTGAGCTTCATACGCAGCGCGTCCATCTGTGCCAAGTGGCCCTTCTGGCTACCAAGCAGCATGTTGCGTCCATTGCGTGTGTACTTGACGCGATA
CGAGCCGTAGTCCGGTAGATCGAGGCTGAAGATCTTGCGCGCAGTATTGATGTCCACATTGTCCGCGAGCTGCCGCTGCGTGAATTTGTACGTCTTTTCC
AGTCCTTCAGCTTCTAAAAATCCGACCTGATCCGGCAGCAAGATCTCAGACTTGGCGGCGGACTCAGCCGCTAACTTGTGCTTCTCATTGGCGCGCTGCA
ACGAGCCCTTAAGTTTTTTGTCGCGGAT