Description :
From Genome Similarity Track
Location :
Scaffold_145:22852- 23859
Transcript NameFunction/comments
g7630.t1hypothetical protein
g7631.t1hypothetical protein

Sequence
1007 bases(100 bases per row)
GTGTCCGTCGTCGTCAATGCGCGGCTCGGGGGTCGACATGTTTTGGTGGTCGTAAGCGAAAGTGGTCGTGCGGTGCTGCGTCGCGTCTGCTGAGGAGCAC
AATCGGAAGTGGTCATGGGGCAACGATGCCAGAGCCGTGACGGCGCTCAACTACATGGCCAATGGCGGTGAAACTAGCACCGACTTGTTTCAGATTCATT
TGGGGGAGGCACGTATGGATAGGTGGCAATCTCATAACGCACGGTTTGCTCAAGTGCTCGAGTTCATGGGCCTCGAGGACGTTTATGTGTTGCTTCTCAT
TGGCGCTACGTTTCGAGCTGCAGTTCGAAGCTGTGGTGATTCCACGGCTGACGCTCGACAACGCCGCAACTGTGTCGACGAGCTCCGAGCCACAGACGAA
TTTTGTGCTCACGGTCGTGCTCAGCATTGCTCGACATGTTGCAGCAGCACGGCGGTGGAATGGTTCCTATCGCCATACATGGTGGCTGGAATTGTTATCG
AGAACTACAGACGTGTCTATCTTTGAATGGGCTGTGTGCACAGAAGTATGCTGGTTGAAAGCGCAAAAGAGGACGAGTTGGTTATGACTGAATTCGTATC
GTGGTATATGACAGAACAACTCAACAGCGAATTTACGTGTTGCAGCGGAGGCGATACAGTAGTTGCCGTAAATATTCGCCGACAGTAGCCAACGTCTCGG
ACTAGGGCTGCCAAACGGGGGCGCTGGGCGTCAATGCGGCGCGTCGCTGTTTGGCCTCCGCGCACTGCTGCAGGTACTTCGGGTCTTTTTCGTAGGCAAA
GACTCGAGGGTCGACTCTCTGCACACGAGCTCGCAACTCCAGCCAGTTGCTGCGAGTACGTTCCGCATGAGCCTCCTTGTCGTCCAGAGGGGCCTCTCTC
AACTCTTGATTTCCACGATCAGTATCGTTATCAACCTCTCCAATGACGACAACCTCAGTGCCCTCAGGTTCGGGTCGTTTGAGCTGTTGTGGCTTTCCCT
CGGGATT