Description :
From Genome Similarity Track
Location :
Scaffold_29:22848- 24054
Sequence
1206 bases(100 bases per row)
CGCGATGAGAATTTGGTGCTGCCAACAAGGCATTACGCCTGGGTTACCTGTCCGATTGCTACCATCCCTTCGAATATGCCCGCGCGAATCCAGAAACCAT
AATTTGTTTCCCGTCCGTCACTTGGATCCTGTAGAGAGATCCATTCCGGCAAAAGCGCCAAGCTCATAATGGGCAGTGGGGTGCACACAGACCAATAACA
GTAGCAACGACGTCTTCCGGGTGTACTCTTCGAGAGATAGCATTCGTTCAATGGAGTATTTCCCGAATCAATAGATGATCTGCTGCCGTATTCAAGTGGT
AGTCACAACTACAGTTTCCATATGCTCATGCATCGAATTAATGGTTGTGCTGACCCATCCAAGCGAACTGGAATGTGAAGTCAACACCTGGAAATCCAAA
CAAAAGCACAAGTGTTAAAATGAGGGTGAAATCATCCAGCAGGGGGATGCAGTTTCTCATACATACCGAAATGTACCACACGGAAGCTTAAGGTCATGAG
CACCCACGTCATTAGCTTTACTTGGATCAACAGCATTTGCGTTTCCAACACGAACGCGAGGTGATACAATGCTTGCATACGGCAATTCCTCAGCATCATG
AAGATGAGTGTCAGGAAGGAGGCAAACTCAAGCAGCGCGTAGACGAACACATTGACCAATGTATCTCCCACGTTGTCGCGATTGATCCCAACCAAGTCCA
CGTGGTATTTTGCGCTCGGAAGGTGAACGACCAACAGTATGAAACTTCCATACAGAAGAGGAATGACCGACTCCAGATACTCGGTCAGCAAGTGGCATTC
AGACGTGAAAAGCACGTCGAGCGTCTCGCTGAGAATGTTGCGGTGCAGGTTGTCAAGATTATCAAGTGGCTTCGTGGGTTTCTGTGGCTCATCAGGTTCA
CTACGAACTGGTTGGATGACCATAGTGGATACGATGGCACTTGGCTTAATTTTGGTGAGGGTGCGACGGAAGCAAGTCCATGATGATGGTTTTGATGTAG
TGGATGGACGATATCTCTCCGTTGGCGTGCGGAACGAGGTACCAAGTTCGCTAATTCTAAACCGCGGAAGAGTGCGTACTCCGTTACCTGGCACAGTCTT
CAATTTGTTGAGTAGGTCCCGTCCTTCCACTGATAGTTTATGGGGAAGGCACGAGTCTAAAACAACATCTTGGCGGGCTTGGTGTTGGAACTTTTCCGAG
TCACGG