Description :
From Genome Similarity Track
Location :
Scaffold_35:228449- 229475
Transcript NameFunction/comments
g2685.t1ETK86879.1 hypothetical protein L915_08569 [Phytophthora parasitica

Sequence
1026 bases(100 bases per row)
ACGAGGGTGAGGTACTTTTCGAGCTCTTGGTAAGAGGGATAGACAGGAAGGTCGAGGCGGTTGAAGCACGTGTGTGCTTTCGGGTATAGGCCTGTGGGTG
GCGCACCGAGGGGCATCATCTGAAGACCGAAGCGACGGATACGACCGTCATGGCTGAGCAGCGCTCGGAAACCTTCAGCGGGGACTCGAGAGGTGCCAGT
GACGAACTGTAGTAGACGTGCACGCTCTTCCTGGGAGAATGCACGCACAGCGTCCCAGAACCACTGCACGACTTGACGTTCGGGACTGGAGGGTCTGTTA
AGGCCCTGCTCAGCACGCATGTATCGGACGTCGGTGTGCGATTCCCAGTCGGCAACGTCGATTGATGGCACGCCGCACAAGAGGAGCTCCATCTCCTGGT
AGTCGAAGACAGCCAGAAGCGTGCGTGGCAGCACGTCGTACAGTCCTTGAAGCAGTGCCTCGAGCTGGTCGTGCACTCCAGCGAACATTTTGTGTCTTAG
CAACAGGGTCAGGTACTCTTCCTTGTTGGCATCCGTTACTGGGATGTCTTTGCCTCCCTGTTTGAGCTCCTCAGTGATGACCGTGCCATTATTTGCCTGC
CGTTGAACTGTGAAGTCAAGTGCGAGGGCTTCGGCACCCTCGTTATCGCGTAACCAAAGTGCGTGGCGATGCAGTTCTGCGTCAAGGAACTCCAGGTCGG
AGAACGAGATCGGGACGCCCAAAAGATGCTTGAGAAGCGGAAGCGCGAGGTGCACCGTCATCAATTGTCCCTCCAGAAGACATTTTGCGAGCAACCGCCC
GACAAACTGGAAGCAATGCAAGTGATCACGGTGAATCTCCCGTGAATTCGGGTTGATCCAGTACCCAGACTGGTCAGCATGCGTTCTCTGAAACAGCCCG
TAGCTCTCGTCAAAGAGCTGCTCACACAAAAGCAGAACCCATTCGCGCAATAGACCGCCCGCGTCCAACCCTGGCTCATCGATAAACTCAATTCGCAGGC
GCTGTCGGAGGTCGGAGGCTGGCACC