Description :
From Genome Similarity Track
Location :
scaffold_28:228353- 230310
Sequence
1957 bases(100 bases per row)
gtctgtggagacacccgtcacctgcggaacggttgctccctgcgcaaggcgcgtcaNNNNNNNNNNGTTTTTTTGTAGCTGTAAAATCATGTAACCTgct
tatcttgctcaaaagacGTGCTACGGTGTGTCTGATCAACCACGATACACCACATAAAAACGGCAGCAACAACGTCAACTGTATTGAAACTGTAGCATCA
TTGTTTGCAGCTTTGATAACACCCTACCCGTCTGTCTGGCGCAGGGACGTGCTATAACGTGTCTGAAGTAGCAAAAACATCCTCTCCATTTTAACTATCG
CAATGTTGTATGCAACTGCGATAATACGCCTCGTGCATATCCGCTCTAGTAATCGGATTTCTGCACGTCAGACAAAATAGGTCGCACAGTTTTGAATGCC
AACAGCGTCAACCGCATCAAACTTGCCGACACGTTGTTGGCAGCTGTATCAACACTAAACCCGCTTATCTGGTTCAAAAGACGTGCTACGGTGTGTCTGA
TCAACCAAGATACACCGCATAAAAGCAGCAACAACGTCAACTGTATTAGAACTGTCGCAACATTGTTTGCAGCTGTGATAGAACGTTACCTTCCTATCCG
GTGCAAGAGGTGGGCTACAAGACTAAACATCTTCCGCACGCGGAGTATTCTAGCAACAGGTTTCGCGGGTATTCACAACACCTAGCCTGGTACATATTGT
GCGTGTAAATTGATTGATCAGATGTCATGGAGGATGACAATTAATGAATCATATATAGATGTTGAGCAACCCTCATCGCCGCGACATTGATATAGACTTC
CTTAGACGTGTTAACATTAATCGTATCTTTGGAAAAATATGGCTTGCATCACCGCTTCTGAGTGTGTGACATAAAATTGTGGATTGCAGGTTTCGTCACG
CACGAGCTCGTTTGAGTAGGGGAACTGATAGCTGTATGGGCGCGACAGAGTTGATGTACCTCAGCAATTCTGACGAGGAAGGTAGTGATATCGTTACAat
caagcagcaattggCTCTCGCAGATGGTTTTTAAGCTGTTAAGTGCGTGCCTTCTGCACCATCAACTTAGAGGCACGGTGAGTAACACAAGAGAGTTTTA
AATTCCCTCGCGATAATCTGACGACTCCCATTAAGTTCAGGACGGCCTACTCAATATGTATTAAAACTGTACCTCGTTCAGTTAATGTTATATATTAAAA
TCAGTGCTAGAATGTGCAATGGTCTTCTGGTGACTTGAGTTACAGTCCCAATGTTGTTGGTAATCGCCTGCGAAGTGCTGGAATTACCAAGTCGTGGGCT
TATCTGATGAATGCCGAAGCTTCGCACGTTACGTACGCTCGACGACCGTAACCGGTAGCCATCACAGAGAGGTATTAAAGATGCTTCATACGGAGGCCTC
TGCAAATAAGGATGCTTTGAGAAAATTGCACTTCATCTGCGTCATGCCTCATTTCAAAAATATAAACTCATAAATCGCAGTCCACGGAAGGTCGGTCGCC
TGTAGAATTGTGGTTCTAGAGTCTGTTGAACAGCCTTAAGCCCTCGTTATCGGTTATCAATATTTAGACTGAAGATGGTGCCAGAGGGCATTCGCAAGCT
AAATGGTagaagcagtgactgcttcTTCCGATAATCAGTAAACATTGAATCTTAGCGCAGTGAATGTCCGTAGAAAGCAAGTTTGCTGTTGCGGATGTCA
ACAATTCGGTCACATCCACCGCGATTGTCTACGTGAGAAACGAACCTATCAATACGGTCTTCGTTGGAATAGATCTatgacggggttacacgaaacCTAA
TGACAGGGGGATGGGCACACAGGATGTGCATGATGTAAACatacacccaaacaaaaatacggtatggggctaggtagccagtagttatgcatgtatctag
attctactatatatatttagtatatgtaggaaaatttaaactttaaaattaggatga