Description :
From Genome Similarity Track
Location :
Scaffold_312:22832- 24139
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_312-snap-gene-0.18Pectin lyase

Sequence
1307 bases(100 bases per row)
ACATGACATCAACCGGCAGCGACACCTCGTTTCTGTATGAATTACTCGAGCGTGCTGAGACGGTTGACACCAAAGCAGCCGTCGCTCGACTCCGTGGCGC
GCTGCTCGGCACCAGTGGGCGAGTAGCTCTTGATCCCCGACACGGCCGCCGCACTGAGCGCCGAGTCGCCGCTGACGGACGCGAGGCTGCCGGACGTGTC
GATCGTGTTCTCGACGCAGTCGCGACCCAGGTACGACTCGCAGCTCGTCTGGTCGCTCGTGGGGACGTAAATGTACCCGCCGTCATTCTCTAGCGTCGTT
GTGATGTTGTAGAAGTAGTTGGACTCGGCCAGCACCATCGCGTTCGAATCGAGCTCGAACGCGTGGTCCGTGTTGTCGTTCCAGTAGTTGTCGGCGATGT
GCACGACCACGTTCCCGCTGCTAGCGACGACCTTGGGCGAGCGACCCGACGTCGTGTGGACGTAGTTGCCGAGCAGACTGACCTGCGTGTCGGCGTCGTA
AAAGTACATGGTCCAGTAGTGGTGACCGTCGCAAGTGGCCGAGTAGTCCGTGTTGCCGTCGAAGTCCGAGTTACTGATCGTCAGCGACGACACCGGCGCG
TTGTTGACGATCATCTGTCGGCCGACATTCTTGATCTTGACGTGGTCGATCCAAATGTTGGTCTGCGGGTCGCTCGAGCCTTGGAGGTAGATGGCATCGC
CTCCCCACACGAGGTGAGGGTTCAGCTCGTGGATGTAGACGTTCTGGATGATGATGTTGTCACCCTGAATGAACAAACCCTTGCCGATGATCTCGCCAGT
CGTACCGATACCGCGCAGCGTCTTGTTGCTGAGGACGTAAAGGCTGTTCGACGCCAAAGCGGCATTGTCATAAGTGATGGACACCTCCGTGCCATCGGAG
CACCCGCCGGTCGTCGACATGTCACCGCCCTGGATGATCACATCCTGGCTGGAGAATCCGTTGTTCTTGGCGATGCACTCGCGCGTGTAGTCTGGACGGC
AGCCCGTCTCCGTGGTCGTGCCTTCGGTCTCGCGGNNNNNNNNNNGGCTTGAGTCAGCAGGATGATGTACGTCTCCGACGACTCGAGGTACTCCTTGAGC
TCGTCAGTGGTGGTCGGCACCACTTCAGTGCCGCCTGCACCACCGGTGGTGGCAGAGGCAACGCCTGGCGCCGTGCCAACAGTGTACGAGTAGGACGACG
CGGCGCTGGCGAGCATGGCGTTGGCCGCCAGGGCGAGCGTGGCGAGGGCAGTGCAGATCGAGAGCTTCATGGCTGGAGTGGTTCGGTCGAGGCGAATTGG
AGAATGA