Description :
From Genome Similarity Track
Location :
scaffold_56:2283- 3351
Sequence
1068 bases(100 bases per row)
TCCTCCATCACTGTGTTGCGGAAATGACACCCAGTGTCTGAGACCCAGGTCTGCGGGGGCCCAAACCTCTAGTACCAATCTCACATCGCGGAGGTCGCTA
CCAGCCAATTGGCACGCTCTCTTGCAACAAGCTCACAATAATCTGAGAGGTCATCTTTCTTGACCAGCACATACTTGGCGCTGCCGTAACTTTCTCCTAT
GTATAAGAAGTCCATGTGGAGAAGTTCGCTTCTTTGAGTAGCTGTATGTGTGGAGTGCCATGGGCGTTGAATGAGCATGCCTCCTTTTACATGCTTACAC
AATAGGCAACGGCTCACGAATTCCTTGACCTTGGACCGCAGATTTTCAATTGCAAACTCGCGATTCAACACCAAGAACATGACATCTGCCCCACGGTGAG
TACGAACACCACAATGTGCAACCGTGAAGATACGTGCCACAAGTTCTTCCGACTCTGGAGGAATCCAcactttgttttttttcaaatacaTGCCATTATC
CCCAACTTCGAGACCATCGATCGGGTCCTTCTTCTGCGCCTACATGATGTGTTCAACACTTGGCCATACGAACTTATCGTCTTGGAGAGGCCACAGCTGT
GACACGGTGTCTTGTTCATCCTCACGCGCAACTCGAACACAGATTTCTGGCGGTTGATTGGTGGCGATTGGCGGCGTCCATTCTGAAACAATGTCAGCCC
AGACATTCTTCACACCCTCAATGTGCTCGATAGTGAATCTTATGTTTGAAATCTGTAGAGCCCATCGCAGGAGTTTTCCACGCGTGTGGTTCTTGATATC
GTCGGGAGGACTGAAAACTTGCACCAGGTTCTTGTGATCGCAGTACATCTGGAAACTTCTTTCTCACTCCAAGAGGTAATCCAGCGAGACGCAGGCTCAA
ACCACAGATTAGGCTTCCTCCTCGACTACAGACTAGTGTAGTTGCGCTCCTCTGAAGATCCCGCCTTGACAAATCAGCAGCTCATGGTCTTGGTCAGTCG
GATGGCTGGCTTCTTTCGAATGGCGAACTTGAGTGACAATAATTGCCTCCCCACCAACAGACACAACG