Description :
From Genome Similarity Track
Location :
contig_47:2282- 3464
Transcript NameFunction/comments
g9157.t1hypothetical protein

Sequence
1182 bases(100 bases per row)
GCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTGAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTA
ACACGTTCGTATGGAATACAAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGT
ACAGACCGCCCCCACCTGTCGGAACCACCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCGCCGACGGA
GCAACACGATGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTG
AAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAAGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACC
CGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCAACTCACAGATCCTACGTGCTTTAGCACGTA
CGAAGAGTTCAAGGAGGAGATCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTTCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGTATGAC
GTGCGTGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGATGGGCCTTA
GAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGC
TAAACTGCATGCGAACGACCCGAGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGT
TCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAG
CCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAGAGGGACCAGCAGGCGCGTGGCGCCCTGCTGGTAATG