Description :
From Genome Similarity Track
Location :
Scaffold_11:228181- 229500
Transcript NameFunction/comments
Phyke_g1541hypothetical protein

Sequence
1319 bases(100 bases per row)
TCACGTTCTGCTCGAACACGAAAAGTTAAGGCAAAGTATGGACCGGAAAATGAAAATTCACGaccatcttcttcagatcagcagcaggaaacgCCGTCTA
ATTCGCGACCTCCGTCATCCCAGGGAGATATTGATAACCgtgatggtgaagaagtggtgAGAAGGAGGCACACCGAGGCACGAATGGAGTTACTCTTTGA
GAGACTCAAGATATTGCGGTATGAAAAAATCCTGAAGAAACGCATCTCACGTACTCATTTTATCTCTGATACTCGAATACTTCCCCGCGCGACGCCACAG
TCTCGCTTTAACGACATGCATGCACTATCGACGTGGTTATTGACGCTTTTGGGTGGAGATGTTGAcgaaagcaacaacaatgacGACCCTCCCCTCGTTG
CGGCACAAAAGCTTCTCCTGGCAGCTGAAAAAGCAGGAGTGTCGGGAGTTGCGCAGCTCAGTGCTCCCTCACTGACAAGTGGAGTTGGAATCGAAGTTTG
TGATCTGCTGGGTGCTCTcgctgcagcggcagtgaGCAAAGGAGAGTATTGTACTGCGCCGCCGGAATATACGAGGGAACCCGTAGAAACTATGGATGCA
TGCGACGAGTTGGATGTTACTGATGATGGGGATCAACAAAGCAACTCTAGTGACGGTTGTGGGGGCTCGACAGCGTCGCTTGCgtacgaagatgatgatg
tgCTTTCGCGCTGGGTTGTCGTGAAAGAATACGAGCATACAGAGGATGGTGATAAAGAGAACGCTATGATCCACTCCAACATTGATCCGGCGGCGTGGGA
GCAAGAGCGGCATCGCATGCTTCCAAAATTGAAGGCCGCCCTTCAAGACAAGCAACGGAGACGACCTGCAGAGGCGTCCTGGCGTATGCGGTTGGATCAA
GTACGCCTGCAAGGAGGAATGATAGTCGAAGACCAGGCCATTACCGGCCAAGAAGTCGCTCATATTCAAGAGGTGGGTCCCATGTTGGCTGCTAGATGTT
TTCAAGCCCAACAAAAAACTCACTAATCTCTCATGTGACTGTTGTCGTGTTTTAGATTCAACTTAAGCAAACAAATCAATTAGAAGGTTACGAAAAGCAG
CTGAACAATTGCTTTTTGCGTGCTCGCCGACTGTATGATGAGGGCACAACACGACTATCCAAGGCTCGTGACGAAATACTGATTGTTCAGGTACCAAAGA
CTGAAATGTCCTATATCTATCTTCACATTTTAGCTAACGCGAAAATGTGTGGCAATCAACAGGATAACGTGAACAGAGAAACAGCCGAGGTGGCAAGGCT
CCAAACTGCCCGTGCCAAG