Description :
From Genome Similarity Track
Location :
Scaffold_150:22815- 24305
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_150-snap-gene-0.23Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_150-fgenesh-gene-0.6Nck-associated protein 1 homolog

Sequence
1490 bases(100 bases per row)
GTCGCGCTCGATTGTCGAGCCGATATTCTTGCTCTTGTAGCGCACGTACTGTCGCTCCTCGCTGTTGAGCGTGTCGAACGTGCTGATCGGGTAGTTCCAG
GGTTCAAGCTTTTCCTCCTCGTCGTCGGAATGTTCTCCTTGAGCTGTCGACTTGGTGGACACCTCGAGATTTGCTATCGAGCGCTGCCTCGGGGCCGACA
GCACGCTCGTCGCTGGCTGGAAGAGGCGGTGGATGATGCTCTGCTCCTCAGTCATCTTGTCATCTCCATCTCCAGCCTCGGTCAGCGACGAGCTTGTGCT
TGGAGTCGAGCCACCTGCTGATCCAGCGTCGTCCTCCAGCGAGATCTCGTCGCCGTTGTCCGCATCGATCTGGATGCGCTGAATCACGCGCGCTACGGGG
ATCCCGGCAGATCGCGACTCGTTCCTAAGCTGCAAACAAAAAACAATCCCAACAGTGTTGGTGTTACTTAGTCGAAATTGGTTGACAGTCCAAGTCAGCC
AACCATTTGCTTTATCGTCATGCGGCTGCCGTCGAAGCGCCTCGCGGCTTCCTTGTCCACGCGAGTCGCTTTCTCAGCTTGTGGTCGTCCTGCTGCTGGT
CGCAAGCTCCTCGTTTTCCCTCTGCTATTGCTGCTGTAAGCCTTGGCCTGGGATGCTGCCGACCTGAAGTACTCGATCGCGTGGCCGCACTCAGCCTCGA
CATCTTGGATCTCCGAGTCGGTGATCCACTCGTCGTTGAGTCGCATGAGCAGTGGGAACCCGCGCCTGCGCGGCAACTTCTTGCGGTACGCCATCGTGTG
CGGCGCGCGCAGTCTCTCACCAGTCGTCTCACTGTGGTGCTTGAGCTGCTCATCCTTGTGAGCCATAGCCAACAGGGCTTCGTCGCTCCCAGGCTGGCTG
AAGAGCGCCTCGAGCAGGTACACGCGGTTGGTCTGTAGCCGCAGCGGGTTGCGCTGCAGGTCGATCTCCCGCAGTCGCGGGCACGACGCGAGCGCGAGGA
CGTCCTCGAGCACGTACAGCAGGTTGTCCTGGAGCAGCAGCACCTCGAGTCGCAGCATCTCGGCCGCGACGAACGCACCCGGGAACCGCGTGAGCTGGTT
CAGCGACAGGTCCACGCGCACGAGGTTCTTGAGCGTGAGCAGGTCCGAGGGCACGGCCGCGAGCCGCTGGCCGCGGAACGCCGCGCTCTCCTTTTGCTCG
AGCAGGCCGCGGCTCGCGGTCTTGGCCGACGCGCGTCTCGCGCCATGAGCTGAGGTTGGCATGCTCCGTGTCGACTTAGCAGACAGACATCTTCCGTGAT
CGAGTGAGGTTCACGTGGGACTGTGCTGTATAAATAAGTACCAGCGGTTTTCAACGCTGTCGCCTGGTCAGCCCTCAGCGGCCCGTGCGTCGCTTGGTCC
GCACACTGTGATCCATTCACTCACAGTTCGATCAACGATGGCATCATCGCTGCTGGACGAGCTGCCGTGTCTGCTGGACGAGGCCGACGA