Description :
From Genome Similarity Track
Location :
Scaffold_284:22814- 27779
Transcript NameFunction/comments
Hyaar_Emoy2813501hypothetical protein

Sequence
4965 bases(100 bases per row)
ACAAAGTTAAGCCTTCGGGTCCTGGTGTTTAGGGTTCACCAGCATTATCCTGCCAGATAGTGACGTCCCCTATTTATAGGACGGGTGCGTGACAACGCGT
AAGAATCGTAGAAACAAGAATCCTGGAAAGGTTCCCAACGGTTGTAAGAAGGGTCAAAGAAAGAAGACCAACGGTAGGAAGAGGGAAACACACAATGCTA
TTCACTTTTCGGTTTACCATCCCGGCCACTAGTCCATCAGCCTACCTTGAAGCTCGCATAGACCAAGTATTTGTAACACCTTCTCTCTCAACAGGTGAGC
CCTCAACAGGTTATAAAAAGAAGCGTTGATTTGTGTATGCTTCAATTTTCATCAATTATTAGAGATACCGGGAAATCATTCCCCTCTTGGGGCGACCTTT
GCCAATGTTTTGTCAGCAACTTAAATATTGCATCTAGGGAGGCGCTCCTCTCTAATCAGCGCTTGATGAATTTTTGCATATTTTTTAAGATAGAAGAAGG
GGTTAATGATCTATAAATCTTTCTGCAAGCACGCCGGCAATTTGTTCTTATATGGCTACTTACTGCTTGAAAATCCCAGCACATCCACGTTCATGGTAAA
ACATGATTCGTACTATACACGGCTGGCTAATTTCCGCACCACCGGACAAGGTAACAGGTGCACGCCCAATCACGTGGAGGTGGGGTTCAACAGGCGTATC
AAGACATCATTTACCTCCGCCTTCATCAACGAATGGATGTGGCGGAGGAAAAAACCAGGTCTGACCTATCGTGGGGATTTATTTGCCCAAATCGAGTTAT
TTTGGTCGCATAACTGATGATTAATGCGATGAAACTAAGCGTGAGAAAGACGGATGTCTTGTGTTGACATGCATCGTTAAATCGTAACGCTCTAATAGGT
ACAATGTTGACTTTGCAAAACTAAGGAAAAAGCGGGATGAAGATTCTATTAAAGACAATTGCGCTCATCCTACAAGTCAGTTCAATCGTATTTAGGCGGT
GCAACACACGAAATTTTTTATTATTCTTGGCCATTATTTACTGCTTCACATGCTAGTAACTATGTTTGTCTAGGGATATTTACCGTAAAAAGTAGCAAGA
AGTCACGCTCGCTAAAATTACATTTCTGTCAGCTTTCCTTATTTTACGATACCTAACTTTAGATATGAAGTCTTGCACAACGGACAGCATTTTACGTGCT
GTTATGTGATGTCTTGCTGAAACGTAGTCTTAAGCCATAGTGCCCTGTGATTTTACTGTAAAACAATACTGTTTCTATATCTAGAGAGTCATCGGGATGG
CTAACAATAATTATGATGACTTATAAGTCACGAACAACCTTTAATTTCTAATTGGTAATTCGATTTTGGTACCTTATCCTCGAATACCGTCTCCATTCTT
AGTTTCCTTTTCTTTTCAAAGCCGATTTGATTGGAATCAAACGCAGTGACCTCACGATTAGCTCACGATAAGTGATAGTCAGAATGGTTGTGCTCAAACT
ATTTCACTATCTACTAGACTTTATAATCTGATAAGGTAGGTAAACGAGAATGGTGCAACCTTTTCACGAAGAACGTTGTATACGTGGTAGATGTACACAC
CGAGTTGTGTATGACAGGTCCGCCGTTTGCAGAAACTCGCTCCACTAACCGAAGTAATGGACTTATCCTCTGACAATATATTCAAGAACAACATTAGCGC
GCAATTCCTGAGAGGGTTTCCGATTTACTTAATCACGGAAAGCCGTAACTCATCCGTTCATCGTTGAGTTTGATTGGAAACCGATTTACGGGAAAAATTA
TGGATATAAAATACTGTATCAATAGATACACGAGCACGGTCTGCTGTAGTGATAGACCTTGCCGAAGAAACAGGATACAACATCGTGCTAAACAGATCAA
CGAACACAAAAATGAAAATTTTATTCCTAATATCTGGGTCAAGGCACTGCATGCACGATCTTCACCATAGACGGATGCTTCACCTCTACTTTCGCACCTG
ACTATCACTTTCCTCTATGCTATGACCAGAAATAGTTTTTCTGCCTTCGTACAAGGTCAATCAAACAATGCGTTACATATGAACTAGAAATGATGTCCTG
ATTCTTTTCATTACCATTCCGACCGATCGGGGTTAATTTGCCGTCGTGTCGTTCGTTTCTCTGAACAAGGATGTAGCAACTCATTTTTGGCTATACCACA
TCGATATAGAATCATATTTATGGATGCTAATGTGCTGTGTACATCAAACTCTGCTTGTAATTGCGTATGAATACATGATCGTGTCGTCAAGAGGTTCTGT
AAACAGGTACATTATTGTCGTTGAAACATTCGATCGTAAAAGAACAGAGGCGGGTCATCGTGTGTCGTATTGGTAGTGTAGTGTCGCACTGATCTGTTCT
GTACATCATGGATAAGAATAGTGTTCAGGTATCCAATAGGAACCGAATATGTATAGGGGTGAACAAAAGTGTATGAATGGATCAAATTAATTACATGGAT
CAAATTAAGTACAGAGATCAAACGGAGTATAGGGATCGAATCGAGTACAGGGATCAAGTCGAGTATGGGGATTCAATTACGAGCAGAGATGTATCTAGTG
TGGGACGAAATATTAAGCAGGGATCAAATGTAGTATAAGGAGCTCTATAACTTCTCATATCACTTCACACACTCACGCTGTCCTGGAATAACGACAGCGG
ACGTTCATCAACGGAGGAGGCCAGTCCCAAAGTGAGCACAGCACTACCATCGACATCCCGAGTCAATGCATGAAGTCGAATACGATCATCAAAGTTAAGT
AGGTTGTATACTATTAAAGTCAAGTAGAAAAGAAGGTTTGTGTATTTTACCTGCTATTGACCTCTCCACGACTATGGAAATGGTTATTTTGCACATTTAG
CAGAGGGACGAAGGAAGGTTACATGGGTTTTGCGGGCGGTGTCCTACCTGGACAGTGCCCTGTCTGTCATAGAGAACAGCTCGAAATAAGCTGGTCTCTG
TGACCAATTCATCACCGCGTATATGGTGGCTGAGTAGACCTGAGGTCCCTCCGTACTCGCGTGGCACTCTTAAAGCCGCCACACGCCTTTATCGATCCCT
GTGTTGCAGTGACAGGTCCAGATTAGGCAACGGGAGAGCACACAGTAGCTAGAAAGTAGAAGGTCCAGCCCACGAGCATCATGCTTGAGCAGGTACAGCT
TCTCCGTGTACGTACTGAAATTAGGTAAGTGTACCGATCCCAGCCAGACACATACAATCGACGCTAATTACACTCTCCACCCTTCAACCGGTGCTCATCA
TCAATCGGCCGGTACTTAAATATCTTGTAGTAAATGCTGGATTGGAGCGAGTATTGACGATCCCCAGCAGTATGAGTTTCAAACGTGACGGACAAATAAG
CAATCACCACAGTCTTGGCAGCCACGTTTCGCAGCACAATATCCAAAAGCGCAAAGCCGCAACAGTGTACTCAGGTATAGACTGATTCAGGCGTAGCTCT
GCGCCTGACTTGTTCCGTTGTAGAGCTTATCGTATCGCAACACCAATCTGCTAGAGCGCGGTATCATGACGCTGGCGGATAGCATCCAAATTGGTTGAAT
AATGATTAAGCGCGTGGCCAGCGTCTTATCACTCGAGCAGCCATCTTTACGACAATAAGTATTCGCCTTCATACGGCGGCGCTTCCGCAATAAATTCGTA
TCCACAGAGTTGAGGCGGGCTATAATCTCAAATCGATGTTTCGCATCCTAAAGGCCCGCCCCGGACATGACAACCATGGATCCAATACCACTATGGACAC
GAACAGTGTATCCCGTAGTCTTGCATACTCATTCACCGGGTCTAGTAGAGGGTCTTCATGTACAACTTTAAGTACTGCAAAACCGTTTTGTGTTCCAACG
TGGTATTTTATGTCGTTGAATCTTTGATAATATAGTTTCAATGCAACAAACACAACAACCGCTGAGTAAGTCGGCCTAGTTGTGCTAGTAGGTCGGGATA
AATTCCTCCTCTATTTCCCCTCTGCTTTCAGATGTGGCTTTCGCCCTCACTGACTACCTGCAACCACTCTCTCTCCCAGAATCCTGCCTGAGCACAGCAG
ATTACGTTCCTCAAATCCTGTGACCTCACACCAATGGATGGACGTCGGCGTTTTCACGCATTTACAGGTCACTGGGCGCAGTATACGTCCGACTTAGAAG
ACGTACGCTGTCCTTGGTTAAAGACCTACCGGCACGTTGCTCGACAAGACTTAAACCGGACTCTTCACTCGTCTGGCCGAAGTAGTCGCCAGAATATCTG
CGTGGTGCTCTCCTTATCCCCACCGTAACTTCGATAAAGGTGTCTCCACCCAGACAACAGCAATCGGTCCCTGCCTCTTCCACATCCAATGCGCCAGCAT
TTCGGGAGGCACCTCTACCTCATTAGAAACGATCGGCTCCTGTATCTTCCAAGCCTGATGAACCGGCGTCAAAACGCGTCTGTCGGACCCGATCGTCACC
GACTCGATCGACATCGCCCGATCCCTTTGGTTCTTCAACCCCGTCGCCGGAGCAATAGGAGGGCAGCGATCAAGATGATTCTCCTTTCGCAGATACAGAT
GATTCTCTGCTTGTGACAGCATCTTCATCCCGTTTTACCGACCGACGTGGAATTACGACATCTCCCTAGACATCGTCGCCAGCTCCGATATCTTCACCGA
TCAACATTGACTCCCCCAGTCCGGCGAATCAACCTCTCAAAAATCCCGCGAGAATATCCATGGTGGATCTATTTGGGGAACCATCAAGCGATTCCGATGG
TACCCTCATCCTTTCTGGTGATCCGCGAAGTTGGTTTAATTCGCTGCTGACCGCCGAGGAAATTTTGGCGCTTCCTGATACCACCGTGCCTCGCGATCGT
TGGGTCCCGGGGTTTGGAGATCGGGTTCCGCGATCAGAGGTGGACGTATCCACTTGGTCCGCTAG