Description :
From Genome Similarity Track
Location :
Scaffold_362:2281- 6975
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_362-abinit-gene-0.35Serine/threonine protein kinase

Sequence
4694 bases(100 bases per row)
TTTCGGCCAGATTTTGAAGACTGCGCCAGCGACATGAGGTCGTATCGGTCATCCACAAGACTATGCAGCAGCACATACCGCTCGCGTCCGCCACTTGGCG
TGAGTGCGAGCAGCTCGTCTGTCGTGTAGCGCAGCTGCTTGCGGTATCGCGGGTTATTTGTACAGACACCGTCCAGCCCTTCGGCACCGTGCTCCATCAA
CGCGGACGAGAGTTCTCGCGCGACTGCAAACGGAAGGTCCACGGACAAAACCTTCATGGCTTCTTCACCGCGTGACGAGAAACTCGACGTGATCCATTTT
GACACGCGGCGGGTGATTTTCTGATTGTCCAAGGAGCTATTCTTGTTCTTGCCGTCTTTCACATGGTGCTTCCCGTCGACGATCTTTACGTCGAAGATCG
GCTGGAAGCCTGCTCCGCCTGAGGCTTCGCGTCCGCCACGCTGGTGCGATCCTCCAGGACCGTTGCTGTTGTTTAGCCCATCATGGTGGGCGTGTGTGTT
CCTGCCGCCAGCAGCATCGTTAAAACTGCTTTTCGAGCTGGCGAGCAATTCAACCATTGCATCGACGAGCGACGAGCTGCTCACCACAACGTCCGCTTCC
GAGGGATTCTTCACTGAGCGCACCTTGACCTGTTTCTTCTCACGCATCATGTGCTTTTGCACAATCACCATCCAGTTGATGCCTTGCTGAAGGCAGTAAT
CCTCAAGATCTTCCAAGTGCATCGGGTCAGGATGCAGATAATCGGCGCCAATACCGTGATTCCAGAGCATCAGCGCGATCTGCATGCGCAATAGCACCGT
ATCCGAAGCTTTTCCAGCTGTGCACACCAAGATCTTCCGCGCGCCACCGATAATCTCCGTACACGCTGACTTTGGCTCCATCGCCGCGAGTGTGATCGAC
GCAACGGCACACGAAACAATCTTATCGATCGAAAACCGCACACCCATCGCAGCGACAGACGAAGCCTTCACATACGCCGCTGGGAGCTTAAAGCGAGTGA
TCAACGTGTCATATCGCCCTCCTTCCGCGATAACCTGAGTCGTTGTGACTGCTTTCGCGGTTGACACGACGGGCAACGCGCCACTGTTACTCATGAGCAC
TGCCTGAAAGATGAAGCCAGACGCATACCGCTCCGGTCGAGGGCTCAAACCAATGTCGATTCTCGTGCAAACGTGGCTCGACAAGCGAAGAAACTCCATC
CCTTCCAGCAAACTGCGCAGCGCTGTGATCCCGTCTGCGCAGTCCTTGACCACTCGCCGCAGCTGCGTTTCCCGTCGCTGCGACTGTTTCCTCTCTGTTG
ACCCAGTGTTCTCGCCATTCTTCTCGTATTTCGCCTTGTTTGCGGCCAGCTTCCTTGCAAACAGTTTCTGAATCTCGTGCTCGATGATCTCTAGTGACGT
CGCGCAGTCTTCCGGCAACAGTAGAAATGGTTTCAGCGCATCAATCGATTCCTGGGTAGTGCCGTGTTCCTTCATTCTCCTTGAGATGAACTTCGCGCGA
CCGGGCTTCATGTTGAGCGGAATCGTCGAGGGTACACCGGCGTGAACTCGGCAAGAAACTTCGTTCCCAAACAACTTTAGCGTCTCGCGTCGAGCACTCT
GGGGGATGTCGCACAGCTCCAATACACCTCGTGAGATGCGAGCGTCGTTGAGTCGCAAGTAGTACGATCCAAGCGATGATGCAAGCGCGTCGATCACCTC
CGCGACCACTTCCAGCCCTTCGAGCTCCAAGAACTTGGATGGTCCACGGTCGTCCCAAATGATGTCGAAATCAGATTCTAGAAGCTCACGAGGGTGTCCA
CCGACAATGTTTTTTCGATACACGCGGTCGAATTGGTAGCATTTCAGTCGCGTGATGTTGTGGCGAGCAACGAAACGAGCGAGGCGCTCCGTGAGATCAA
ATGGGAGCGAAACAGAGACACCTGCGCCATCCAGCAGTCCACACGCGCTTTGAGGGGTCATCAGCGGGATACCAGTGTAGTTGTGCTCTTGTGCTCTTGG
CATCAGCAGTGGCGTCGTGTGCTCCACCGCGCCATGACGCTCAAACACTTTCTGCAAAACACAGGAACAAAACGACATTAGATGTCAGCTCCCTCAGCAA
CAATACTTCGCTCGCTCACTGTAGTTGCAACTCACCTGCAGCACATTTTTCACGTATGTCTTCGCTCGAAGCTCGATCATGTAGCTGCGCATTTTTACAG
ACTCCAAATGATCGTATGTGTAGTCAATGTGGTTCACCGGTTCTTGTATGAGCAGCGCGTCGATGAGCTGGCCAAAGAACTTGCCCTCGGGGTTTGCGAG
GATCTCCAGCGCCTCTTTCAGGTACGTCCCTTCCACCTCCATCTTTGGCGGCAACAGCGAGCTCGACAGCAACTCTGCGGCATTCGGACGCTGGGCTGGA
TTCGGGTTGCACAGCCACAAAACAATCTCTTTCACGGAATCAGGCGCGTTGAACTCTGGTGGAAGCGCGTGTCTCTCTCGCAGCCCCGTCAGTGCTTGCG
CGCGCTCCATCAGCGTTGTGAACGGTGGAGACCACATCTCAAAGAACAGAATGCCCAGTGAGAACATATCCGCTTTCTGGTTATACCGCTGTCCTTCTTT
CTCCTGCTCAGGTGCGCGATAAAAAGCAGTTCCAACTCCGGTCGTGATGTTGGAGTTCTCCATCTCGGACGCTGACATGAAGCTTGTGTACTCTAGAGGA
TGAGCTCGAGGCAGCGGAGCCACGCGCGTGCTCTCCAGATTCTCAAACTTGAGCTTGTCATACAATTCTGCAGCAGAAGACCCTGTCGATTGGGAGAGAA
AAGTGCCAGTCGGGTTGTTGATGCCACCTGTGCCACCACTACCGTCTTCTCCGATAGTAGACTCCTCTCCAATCTCATCATCGAGGATCTTTGGTGGGCG
AACAGCCAGTCCGAAATCTCCAAGCTTCACTGTTCCTTCGGCGTCCAGGAAAATGTTCGGCGGCTTAATGTCGCGATGGATGATCCCCTGTCGATGAATG
TACACGATCGCTTCGAGGATTTGGCGAAAGAGCGTCCAGATCTTGTCAGGCTCCGAACACAGTGAGCCCTTGTCGATAACTTCACGCAGCGCCTTCCCTT
CACAGTACTCCATCTGAATGTACAGCTTCTCGCTCATGCGTTTCTCCTTTGGTCGTGGGCTCTTTGCTGGCAGCGGTTTTCGCCTTCTGTACTGGTGCTC
TCCACCGTCATCATCGCTCGAATCTTCAAACTCTTCGTCGATCGGAGCTTCTTCGAGACCTTCCCAGTCGAATCCGTCGTCGTGGATGGACGTGGAATTG
AGATTCTTGCGATATGGATTGGAACTTCGTCGGCTGTCGTGCTTGGAAGTCGACCAGAGCCCCAGGCTGGGAGGATTCACCGTACCGAGCCAGTCGTCAT
CGTCGTCGGTGACGCTGGTTTCCAACCCCAGTCCAATTTCGTCGCGCGTATCTGAGGACTCAAGCGACACCTGCTCTTCGTCTTCATCATCATCACCCTC
GCCATCGTCGTCGTCGTCGTCATCACCGTACTCGTCAAAGTCGTCGTCGCTCGACTCGTCAGCACTGAAACCTCCGCTCTCTCCTTCGATCCACGCTTGG
AAGTACCGCACAATGTGTCGGTGCTGCATCCTCGAGATCGTTTTCACTTCGCGCAGGATTTTCTTTTTCATGGTCGGATCCTCCGGGTCCAGTTTCACCT
TCTTCACGGCGTAGAGCTGACGGTCAAGACGATTCCGCACTTTTACCACTTCACCTCCACCACCACGACCTAGCAGCCCCAGCTCCTTGAAATCACCGTG
ATAGCGCGAATGCAAGTGCTCGGCGTCTAACGAGTCGGTCTCCTCTTCCGACGAGTCATCCGAATCGCTGCTGGACTCGCCATCGTCATCATCACCCAAG
TGATCATCACCACCACCATTCGATCGATTGCGCTCCAGAATCGTTGACACGCGGTCGCTGCTGCTCCCAAAGTCGCTCTCGGTGCCGTCAAACTCATCCT
GGCTGCCGCCGTAATCGTCCACTCCGTCGATGCTGGATCGATGTCGCCTCCTTCTTCGGGCATTATTGCGCTTCTTCATCTTCTCCTGTTTGCGCTTCCG
CTCTGCGTCAATGATCGCGAGAATCTCCTGGTTCTTCGCGAGCGCCTCTTCTTCTTCCAGCTGGTGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCGATCTCGCGGTCTTGCTGGCGCTGCATCATCTGGTCAAAGAACGACGATTGGTCCTTCAAGTGCTCCTGGATAAAGTCCGTGGCGTGCGACACG
ATATCATATGTCATAACGTCACCGATTTTCTCTTCTGCGAGCTTTACCAGCTCCTTTTCGAGCTTCTTCGTCTCGTCATCCGAGAGTCCGTGCTTCGCCT
CCACCGCGATGTTCGCCGCCTGCTTAATCGGGTACGCGCGTCCAAAATCAATGTGCAAGAGCACTTCCGCGGTCGCCGCTGCCGCACCCACACCAGCTGC
ACCGCTTCCTCCGCCAAACGACTCGCAGAAGAGCCGGATCGTAAAGATGTAGTTGTACACGGGTGTGGACGATTTGAGCTCCAGGTCGTGGTCGTAGATC
GCTTGCAGCACTTCCAGCTCCTGCGCCTGCATCTCTAGCGCCTGCTGCAGCGTCGCGGCGTCGAAGAGCGTGGAGTGGAACGCCATCGCCGCGG