Description :
From Genome Similarity Track
Location :
Scaffold_233:2281- 4720
Transcript NameFunction/comments
Phyag_g3757conserved hypothetical protein

Sequence
2439 bases(100 bases per row)
CGTCAGGACAATGCGTCCAGCAACGCTCCAATTCGAGACTCGGCTCCTTCGTGTGAATGGCGTCGACTGCCCCATCGTCCAAGAGacccaccacctccac
cacctccgggGCTACCGTCTTCTTTGCGGCCTTCTACGTCGATCTTCAGCCAACGCGTCGATGTGCCACTAGCGAAGTCAAATTCTTGGATATGCCGAGT
ACGAACTCGCAACAACGGAGCAGGGGTCATGCCACCAccgttggcgtcgttcgAGTCGCCAAAACGCTCCACGTCATCCAGCAGATGAAACGAGAACGCA
CTGAAAACTGTGATGAGAAAGCGGCTTGGGAGATCGGGCGACACGTCGATCTCGATGGGTCTACCTCGTGCTTCAGCCGGTCGAATGATCAAGTTCGGGT
TGCCGAGTAATCGATGCACCACGAAGTACGAGTCACCTCCGCTGATAGTTCGAGCGCAAGCCTGAAGTAGTGCACTTACAGCACGCACACGCTCCTCCGG
GGCTGCCGCAAACCGCTGGATATGTGCGTCGAGCACCTCGAAAATGTGCTCAAGCCCACGATTCTGCAATGGCTGTCCGCCAGAATCGGAAGGACTCTGC
TCCGAGgcctgttgttgctgttcaccaccaccgtagAGCGTATCGTTGATAAGGAAGAGCTCCGGCAAAATATCTCGCAACGTCTGCTCGAGCGAGATTG
GCTGGGGTCTGGGCAAGAAGATTTGAGCAAAGGTCTCTGCGTGGCGTGAGAAGATAGCCAGGTAGTCATTGCGCGTTCTTGCGCGTGCAGCCTTCTTACG
AATAGCAATCTGTTCTGGAGGGTGGATCTCCCATAGCAACGGATCAGTCTCGCGCAAATACTGAACGCTCCCCAGTTGTTGGTACGATGCTGTCCAGCGC
GCTGTAGTCGTCCGTAGTTCCTTGGTATAAGCGTTATTCATGTCTTGCCGGTCTGAAAGCGGAAGGGATAGAGACGCTTTGGCCACCGTCGGGGAGCGGA
ACCGATAGAACGGggtcttgcgcttcttgtctgATGTTGAAAAAGGTCCGAACGACGAGGAACAATGAGCTGGTAAAGTCGAGGAAGAACTCGCAGTCGC
AGATGCCAGTTTACAGTAGAAGGATGCACGATTGAGAGCCGCCACCCAAGCACTAACAGCAGCGTCTGTCTCCTCGACAACGCGCAACTCGATTGATTTT
CGTCTACATAagagcatcagcagcaaagtaGGGTAGATTCAGTGTCGATCAAAATACAACAAGCTGAGGAGAAAAGTCAGCTACGTACGGACGCACTTGA
TGCGTGAGTCTTGCAGAAAATTTAAGCACTTGCAGGCGACGATGAGAGCTGGCACTCGATATACTGAAATTCATGGAGTGATCTCCACGGCcacgctgca
cgagcgcgTGGTCCAGAAGTACAGCACCACGCGGAAGTCCATCAGCCTCGCTAGCAAAATAATACAGTCGGTTCCCTTTAAGCTCAAAGTATCGCGGTTG
CCATGAATTGCCGAGTCCGTGCTgtttccgcttcttctttttgaGCCATCCAGTCTTTTCGGGAGCCATGTGAGTCGCTGGATTAGTGATACTATCATCG
TCTGCTATTGCGAATTCGCCGTGCGCCGAGGCATGCTCTGACGTCCCGGAAGGTTGAGATGATAAAGAAAGCATAGACCATGACAGAGGTAGAGCCGACA
CGTGCCCGTTactgtcctcttcttcctcctcttcgtcgttaTCATTTTGAGCTTGGTCCATGGattcatcttcatctcttCTATCATCACTAGTTCCATC
ATTACCACCGTCACTATCGTCCTTGTTGACTGCCATTTGCGCTTGTTGGAGCCGCAATACCTCGAtatcctccacctccagcgtgCTAAAAGGGCTCGTT
TGAGGCTTATCCAGTCTCGATTCTTCATGTTCCCTTCTGCTGAGTTGGATTGGTATTAGTGGTAGATATAGTGGCTGTGGCTCGATGTTTTCTGCGTTAT
CGACGTCCTCAGCACGTTCAGATTGAGTAGGCTGCCCGTCTAAAGGTGGTGACACCTCTGGCTGACGAACCACTTCAGTCGGGGGCGATGGGGGCGAAAC
TACCGACAGGGAATCACTTGTTTGCTTGGAGACTTCAGCTACGGCCTGATTAATACGGTGAGCGAGCGTGATATGCTCTTCATGAAGTTCACCTGAGCGC
GTGAGTGGCAGTGATACCGTCACGGCCCAAAGCTGTCGACCAATCCACTGCAACGAAACGTCCGGAttgatggcgttggcgctggcattgctgcttgacg
aacAGGACGTGTCAGCTGCCCAATCTGAAACTACCCGCGCAACCTTGGAAACAatggcagctccagcctCCATGGTCCAGCATGTGATACAGGCTTTGAA
AAAATCGTCCTCACGATACCAGCGTTCCACTCGAGCCTG