Description :
From Genome Similarity Track
Location :
Scaffold_923:2281- 3530
Transcript NameFunction/comments
Phyta_totarag11369hypothetical protein

Sequence
1249 bases(100 bases per row)
agtatgacttttaggaggtaacttcatgacaaataagcaaataaaatacagctctcaatttcacctaaatAGTTAATTACAGTCTTTAATCTAGCCTTAA
TTATATTTGCAGGGCGCAAGTATAGTCAAGTTAAGTTAAAGAAACCTACGattcctcatacacgtgcgctcACGTGCcagcttaagtattgggcgaagta
ggcccattacacctGGTAGCATTTTGTAGTCCGTCCAACGACCGACTAAACTACACGTCCGTATGGAGTCTTACGAACATGGGCAAGAGAACCCTACCGA
TGGACGGAAGCCCAACTGCCCctgcaacgcacattgcGCGTGCAGACTGTCCCCACTGTCTGACCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTC
ATTGTCGAGGCGTCGGTagtggcgatgctgcgcacgctATCACCCACAGAGCAACACGGTGTTGCTCTGGGATTTATCATTAAGGAGCAgccagatgctg
ctgcctctaCGACAGCGTCGCCCCCGACCATACCGCGATCGATATCGCTAAAGATCCACGTGAGCTACTACGTCGGAAAAGAGGGCGAACCTCTTCCCCG
TTGGCTTGTCGGAGTCGACACAGCTATTACGGCTCGACGTATCGTCGAACCGTTGTCTAAGGTTGCGTTCCATGTCGTGCCTTGGTGGACGAGCAAGGAG
TTGGGCGTACTGACGCCGGCTCGCGGACCATACGTGCCTTAGCACGTACGAGGATTTCAAGCAGGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAGTGAG
TTCCGATCGAGGGCTGAGttcctcgatctgcagcagggcAAGCATGACGTTCATGCATACGCGCAAAGGGCATGGTACTTGGTCTCGAACATCGTGACTA
ACCCGATAGACGGGACGACCAAggtcgtcacgttcatgaaaGGCTTGAAGGATTGGCCGGTCGAGACCTACCTCTTCCGAGAATACCCGAgtactcgaag
ctgcgatcACGTTCGCTATGCAAGAAAATTTTAGCCTGCGGCAGGCTAACTGCATGTGAACTTGCCACGGATGCCACGGCCGATGATAAGGGCGGGAAGT
CCAGAGCCAATGGAGCACTCGAACGCGACGTCTGGGAGTAACCCGCCACATCGTAGAGCTGACGTACGATGCTTCCGTTGCGGACGCATCGGCCATTTGG
CGCGCTAATGCTGCATGGACAGAGAGGCCAACGTGGCGGTTCCGGGCAT