Description :
From Genome Similarity Track
Location :
Scaffold_65:228073- 229753
Transcript NameFunction/comments
Physo_157859Os05g0222200

Sequence
1680 bases(100 bases per row)
GCGTACCCCACGAGAATGAGCATGTTGCGAGACACGTTGACGTTCTCCACGCCGTAGCTTTTCAGCAGCTCCCAGGCCTCCTCTGTGTTCACTTGCGAGA
AATGCTCGTACATGAACGCCTCGAACGAGTACGTGTGGAACGCGAGGTAGTAGCCCCACTTCCAGTACGCAGGGATCGCATCGAATGGCACCATAAAGCC
TTCGCACAGCATGAACATGCCGAAGAGCCCAGCGCCCAGTGCGATGCCCATTATATAGTGCGGCACCGCAGCACCCAGCAAGTGCATCATGGACTCGGCC
GTGACCAGCGACAGCGTCAGGTTAAGGAAGAAGGACCCGAACGAGTGCACGTGGGCGAAGTAGACGACGATGAATGCCGCCAACAACGAGATGAACATGA
CGCCGGGCAGCGCACCGAGGAGATTGGCCGTCGTGTAGCTCGCGAGGTGCAGGGAATGGGACCGAACTTCGCGCTCTAACACTGCGCGTTGCTCCAATAG
AGCGGGCAGAGCTGCAACGGACATGAAGACCAAGAAGGCCTGCACGTAGAAGAGTAGCGGCACCATAGCGGAACTTGTAATGTCTTGGTTGGAGCTCAAG
TACATGGTGCCGACCATGAAGGACAGCAAGATGTACATGAGCACGCGCAGCCAGAACACGCCCGGGTGGCGCCAATTGTTGACCAGGTTGCGATGCAATA
GCACGCAGAACTGGTCGAGTCTTGACGGCCGCATGGCTCGCAGGATGGCGACGTTGATGATGTTGACGTCCCGCATGTAGCGATCTCGAGCCACGTCAAC
GCGCAGTCGCTGCGGCTCGGCGCCTTCTTCCAGTGCTTCTACGAACGGGCCAAGCTTCAACCCCGGATGGAAGTCCACGTTGACTAGATGCACAAAAAAC
TCCGCCGGATTCGAATAGAGTGGGCACACGTAGCCCATGGAGAAGAAGTGTGTGAGAGCTGCTGCCGCGGGGCCGAAGTACACGAGCTCTCCGTCGCTCA
GGATCACCAAGTTCGTCAGCATCTCGAACACTGAAGACGAAGGCTGGTGGATGGTGCAGATGACGTTCTTGCCGTCTTCTAGACACAGTCGCTCGATATG
CTGCATCATACTCCGAGCTGACGAGGCGTCGAGGCCCGATGTTGGCTCGTCCAGCAGTATCAACGCTGGGTCTGAGAGCAGCTCTACAGCAATACCGAGT
CGCTTGCGCTGGCCAGACGAAATGCCCTTGTGGAAGATGTCCCCGACGTTCGCATGCATACACGCGCGCAGCCCCATAGCGTCGATTACGTCTTGAACTC
GAGACTCGCGCGTAAGTATTGGTACGTGGCTGGGCAGCCCAAGGCCCGCAGCGATCTGCAGTGTCTCAAGAACGGAGAAGGATCCGAGGAACGCCATGTC
CTGCGAGACGTAGTTCATGATGTAGTGGAAGCTGCGAGGGTTCCGAGGATGGCCATTTACATCGACAATGCCTTCGACACGCACGCCGGGACCTCCAGGC
GGCACTCGATCCGCTAGAATGTCGAGTAAAGTGGTCTTGCCAGCCCCGGAGGGGCCTATGATAGCGGTGAGGTCTCCGGGCCCCGATCGGCCCCACACAT
TGCTCAGAATCTTGCGCGGTTGTTGGTTACTTGATCCGCTCTTGGTGCTTGTGCACTTCGACAACCAGCGCTTCTTGGGC