Description :
From Genome Similarity Track
Location :
contig_57:228069- 231733
Transcript NameFunction/comments
g10988.t1hypothetical protein

Sequence
3664 bases(100 bases per row)
ACCTGCTTCTTTCAAGTTTGTCAAGCTGTACCGCTTCGCCACAGCTTTTGACAAGGTGCTGCTGACGGTTGGCATTATCACGACGGGGGCCAACGGCGCA
CTGTTTCCTTTGATGGCCATTGTTTTCGGCAACGCGCTGACGGGATTCGCTTCCACGCCAGTGGACATGGACTCGGTGAACAGCGCATCGCTCGACTATT
TGTACATCGCCATCTTCATGTTCTTCACAGATTACGTTTCGTACGTGGCGTTCTACTACAGTGCGGAGAGGCAGATGAAGGCCTTGAGGGTGAGGCTCTC
AACACATGCTGTACATGGACATCAGCTGGTATGACAAGCATGACGCACTGCAGTTGTCGAGTCGGTTAACGGGAGACACGGTGAGAATCAAAGATGGCAT
GGGCCATAAGCTCGGCTACGCAATCCGGTACATGATTCAGTTCATTGTGGGCTTCATCATTGGCTTTGCGCGTGGCTGGGATATCACGTTGGTGATGGCG
TGCGTTATGCCTATCATGGCCATCTCGCTCAGCTGGCTGATTAAGACAATGACAATCATGGCGGAGTTTGCACAGAAGGTGTATGCTGAGGCTGGTTCAG
TCGCAGAGGAGACACTGGGATCGATGCGAACGGTGGCGTCTCTGAACAGTGAACACAAAGCGATTCAGAAGTTTGAGAAGAAGGTGTTTGAGGCGGAGAA
GGAGAATATCGCACTGCACAAGATGTCGGCTGTCGTATTCTCGCTGTTCATAGCAAGTATCTACGTTATGTATTCGGCCGGTCTGTGGTATGGGGGATGG
AAAGCTTCGAAGGAAACACTACACCTGGAGACGTGTTCGCCGCCTTCTTCGGTGTTATGATGGGATCGACTTCGCTTGGCCAGATTTCGCCTAATATCAC
TGCTGTCTCCAAGGCTGCCGGCGCCGGTGAAGAACTCTTCGCTATCCTCGACACTGCCAGTGTCATTGACGCAGAGAAGGAGGGCGAAGGCGTCATCCCT
GACTCCTGAAGGCAAAATTGAAGCCGTGAATGTCAACTTCACGTACCCGAGCCGTCCCGAGGCGCAGATCCTGCGTGACTACAACGTCACCATTGAACCC
GGCCAGACGGTGGCGTTCGCGGGTGCTAGTGGCGGCGGCAAGAGCACTCTCATCGCGCTGATCGAGCGCTTCTACGACCCCACCAGCGGCACGATCTACC
TGGACGGACGTGACGTGAAGACGTTGAACGTCAAGTGGCTGCGCTCGCAGATCGGCATGGTCTCTCAGGAGCCTGTGCTGTTCGCCACCACCATCTTTGA
GAACATTGCTATGGGCGGTGACAACGTGACTCGCGACGAGGCCATCGCCGCGTGCAAGCTGTCGAACGCGCACAACTTCATCATGTCGTTGCCGGAGAGC
TACGATACGTTGGTCGGCGAGAAGGGCGTGTCTCTGTCTGGCGGCCAGAAGCAGCGTGTCGCCATCGCACGTGCCATCGTGCGCAAGCCCAACATTTTGG
TGCTGGACGAGGCCACCAGTGCTCTCGATAACGAAAGCGAGAAGATCGTGCAGGCGGCGCTGAACGACCTCATGGCCACGACGAACATGACGACGTTGGT
GATCGCCCACCGTCTGAGCACGATCCGTCACGCCGACAAGATTGTGGTTCTGAACGAGGGTCACATTGTGGAGAGCGGGACGCACGACGAGTTGCTACAG
ATCGAGCACGGCATTTACCAGAACATGTATCGTATCCAGGAGCTACGCTCTCATGAGGAGCAGCAGGAGGCCGAGAAGCGCGAGGCGGAGAACGATCTTT
CGGGTACGAAGCTGTCTCGTTCAGTGAGTGCTGTGTCGGCGAAGACGGACATTTCTGTGAGCGAGGTGGAGAAGAACTTCCTGGACAAGAAGCCGTTTGG
CTCACAGATATATTGAAGCTCAACAGATTGGAAGCGAAATACTTCGCTATCGGGATGATCGGGACGGGCGTGGGAGGGATCGTCATGCCAGCGTCTGCAC
TACTGACCACAGGGATGATCATCCATGACGGAACAGTATGGGCTGTACCAAAGGTCTGGCGAAAGATCCCATCTGGCCACAATGTACAACGATGTGAAGC
TGTACGGGATCCTCTTCCTCGTTGCTGCTGCGGTGATCGGGATTTTCATGTACATGCAGATCTATTGCTTCAAGTTCATGGAGGAGAAAGTCACCACGCA
CTTACGTACGGCGAATTTTAGGGGCTTGTGCCGTCAGAATGTTGGCTTTTTCGATGAGAAGGAGAACGCTACGGGTGCGTTGACTGCCGACCTTGCCACG
AACGCTACGAAGGTGTCCCTGCTGTCTGGAGAATCGCAATCCGGTGCTTTCCAGGCGGTGTTCACCTTAATTGCTGCTCTCGTCATCTCGTTCGGCTTCG
GCAGTTGGCTACTCACGTTGATCATGGTGGCGCTCATTCCGTTCTTGCTTTTTGGAGAAGTGGCGCGAATGAAAGAGATGGAGACCAGCGGATTGATCTC
GGATGACTTGGCAACCCCTGGTGCTCACGCGTCTGAGGTTCTCAGCAACATTCGCACCGTTGCCGCTCTGGGCATCGAGTACAAATCTGCGAGCGTGTTC
GACGAGCTGCTGCAGGAACCTCTTCGCAAAGGCAAGAAGGAGGCACAGGTCAACGGTCTCTCACTCGGCTTCAGCTCCTTCATCCTAATGGCGACAAACG
CGCTCATTTTCTGGTTCGGCGCCAAGAAAGTGGACGACAACACAATTACCTTCACGGAAATGATGCGAACGATGATGGCAATCATGATGTCCATTCAGAT
GTCAGCAGTGGGTCTAATTTCTTACGTGATGCGCCCAAGGCGTTCAAGGCTGGGTCGACCATCTTCGCCATCCGCGACCGAATCGCCCCAATCGACTCGT
TCAGCACCGATGGTCTCCGTTGGCTAAGATTGAGGGTCGACTCGAATTCAAGGACATCTCGTTCCGGTACCCGACGCGTCCCGAGATGAACGTGCTCAAG
AACTACAACCTCACCGTGGAAGCAGGCCAAACAGTTGCATTCTGTGGCCCGAGCGGCGGCGGCAAGAGCACTATCATCTCGCTGATCGAGCGCTTCTACG
ACCCTGTAGTCGGTGAGGTGCTGCTCGATGGCCACAATATCAAAGACCTGAACCTGAACTGGCTGCGCAGTCAGATCGGACTGGTCGGACAGGAGCCCAC
ACTCTTCATCGGCACCATCGCCGACAACATCGCGTACGGTCTGGCAGAGCAGCCTAGTCAGCAGGAGATCGAAGAGGCCGCCAAGATGGCCAACGCACAC
GACTTCATCACGCAGTTCCCGGACGGCTACGCGACCCAAGTGGGGATGAAGGGCGAGCAGCTGTCGGGCGGTCAGAAGCAGCGTATCGCCATCGCGCGAG
CCATCCTCAAGAACCCCAACATCTTGCTGCTGGACGAAGCCACGAGCGCACTGGACTCGGAGAGCGAGAAGTGGTGCAGGAGGCGCTGGACAAGGTGGTG
GCGTTGAAGCGGCGCACGACGATCGTCATTGCTCACCGGTTGTCTACGATTCGTCACGCTGACAAGATCTGCGTGGTGAGCGGTGGCAAGATCGCGGAGC
AGGGCACGCACCAGGAACTGATCCAGCTCAATGGTATCTACGCGGGTCTGATAGAGTCGGCGTC