Description :
From Genome Similarity Track
Location :
contig_30:228058- 230723
Transcript NameFunction/comments
g6558.t1hypothetical protein

Sequence
2665 bases(100 bases per row)
AATAAATTTTACTATTCTACGCTAACTATTTGCTAAATCTCAACTCACATTGAGCACAGCAGTGAGCCGCATACTACCCTGAGTAGACTGAGGGACCCAC
AGCAACAACGAACCACCTCCTGTACCGGGGAGACCCATAAAACCCGGACGCCACCGATCCAAATACAGCGTCTTGCCTCCCAGCCTCGTCACATTTGATT
TCCACATCACGGTCTGTCCAGCTGGAACGGGTACCTCGGCGACCTTGTCGCCGCCAGACTTGATGTTCACAGACACATCCTCGGTGTCAACGCTCTTGAA
TGTGACGATGACAGTTCCGTCGCCCTCCTTCTTCCACAAGCCGTCACTATTATTGAAGGCATCTTGCACAATTGTCATACCCAATGCTTTCTCCGCTGTA
CCGTCATCAATCTCACCGATGAGCTGTGTTGGGCCACAAATCGGCTGGAAAAACTCGGAAACAATGCCCGTGACAACCCACATATCCCAAATGGCATAAA
ATCCAAGGGCTTTGTCCGCAACCTTGAAAGCGTATTCCTTAGCACTAAGGAAGGTGCCATTGCTGCTCGTTCCTGAGCTGATCAGATCATCCATGATGCT
TGCAAACGTCTTGCGAAGGGTGTCGCGTGTGGCGTAGGCTGTTTTTTCGTCCGAATCCGCGATCAAATCGTTCATACAGTTGTTTGTCGCGATGGGGATA
TCCTTCAGCACCAGGTTCGATTGACTCATGGCCACGCGAATGTCATCTTCGGACATTCCCGGATTCGTTTTAAGCAATTCAGCCACGGTCATCCATGTGC
GATCCAACAGGCGCTTCATATCATATCCACAGGTGGAGTTGGACTCCATCGCGGACTTCAAACTGGTGATGTCGAACTGGTTTAACGAGCTGACCGATTC
ACCGAGCGTGATGTTCTTCATGAACGATTCGAAATTGTCCCAACTTGAAACAATAGTATCGGAGTTTTTGACGGCTTCTCTCAGAATGAACTCTGCCGTT
GTGAGCACTCTGTCTGCAAACTTGACGCTGTCAGACACTTTGATCCCAAGACAGTAGGCTACTGCTACGGGTATGTCAATAACCACGTTGTCCGTCTGGT
AGAGCACTGCAAGAATCTTGTCTTGTGTTGACTCGGGGTCAGACACCTTGGCGTAGCGGATGTACTTGACCAGTGACTTCGTCAAACCCAGCATGCTCTT
AACGCACTTGAAGGCCTGCTGAATCCCTTTTGCCACTTTATAGAAAGCGCCGAAAAGATTCATCGTGACGAAGGACATTGTCGATTGAACCACCGTTCCA
ACCTTGTAAGCAACTTCCAAAGCACAGTCGTCGTTCTGCCGGATGCACTCCAAACCGCATTCGACGGGGTACGAATACGGACACTGCGCCCAACACATCC
CATGTTCGCTGTTGAATCCGAGCGGACACGTCTTCGCAATGTGAGACTCTCGATAACACACCGAGGTGAATGAAGTGTCGAGCTCGGAGCCGACCCAGTT
GACGTACGTTGCCTCGATCGTACTGGTAGCGTTCATCACACTACCCGTCGTGAAAGCCACGCTCATGGCGTTCGAGGAAGCAGAAAAATCACTCGACCCG
GAGCCAGATACAGTTGAAGGCACGTCGTCGTCGCTGTCACTCGCTTCGTAGGACTAGTTTCAGATCCATCTTCATCATGTTCGTCACTGCTTGAAGAAAG
TGCGGCTTGAATTACGCTGTCGGTTGAGTCTGCATCATCGCTGTCTAGAGAATCGTTGTCACTTCCCGATGACTTGAAAGAGATCTTGGTGGACGTCAAC
GCGCCAACGTCCGTGATATGTCAATGTCAATAGCGGCCGTCACTGTAGCAAGCGGAGTTGACGTCCTTGGCCACTCGTCCAGTGTTAGGATCTTCGCCGA
AGCGATTCCAACAAGTAATGCAGCGAAGACGGACAAGAGCATTGTCACCCTGGCCATCTGGATGGGTCTCGCGTCAGCGAGGAAGCTTGTTGAGCCTCAA
GTGGGACGAAACAAAGAATGAGGTGGTCGAGAGTGAATTGTTGAAACCTGCTCTCCGAAAACGAGTTTCTTTGTTGCAGTGTTTGTTGGTTACCGGTACT
GGACAAACGATCTTGTGCTGTGTCGGGTCACAACGGAGGGCGACTGCCCCGATTTCGCCAGATGAGCATACCGTGTTGTAAATCAGTTCCGGTGGACATG
TACGTGTACTGCAGCGTGGTACTTCCCGTCTTCAACAATGCCACAGCAAATTCTTCCAATCATGCCCAAACCGTCCGCGGACTAGCACAGCTCGGCGCCA
TCCTACCATCTGCCTGCGGAGATACGACCACGCCGCGTGCGTCATGGATACTTTGTGATGCTCTCCTCCAGTCGCCTCCCCAGCGTTCCTGCTTGCTCAA
AATATCTCCTGTGTAAACTCAGCGAGAGACGCCACATCTTGTGACGTGGGGTCTGTCGAGATCTGAACGGGGATTGGCATGCCCGTTCTCAAAAACGATG
AGGCGCGTAGATTAGCTCGCAGTCGCAAATTGCGACCCGCAAACGCGTGGATTGCCAGTGGTTTGCTGCGACTGCTACATGTACATGTACAAGATTTCGT
GGTGCTGTTGTGGGAGCGTGTTGCCGATTTGCGTTGACCTTTCCGCTGTTCGATAGCCAGCTCGA