Description :
From Genome Similarity Track
Location :
Scaffold_122:228034- 232370
Sequence
4336 bases(100 bases per row)
GGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTTCCATGATGAGTTCAACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGG
TAGCTACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGAATCTGAAGGAGTTCACGGGCAAGGATCAAGA
TCAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCAGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTA
GCGGGGCCAGCCAGGAATTGGTATCGGCAGCTGGGTAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGG
GAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTGCATCGACTAAATGTGGCCGATCTACGGGCCAA
GTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGGCGGGAGACGTGGATCTGGCCGACAGGCTGACCCTG
TTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATC
GCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGA
CCCTGAAGATTACCGTCGGGTCTGTCTCACTCCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTATCCGGGGACCGT
GGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGCACACTGAATCGGGATGCTGGAAACACC
TGGTCTGTGAGAAGTGTGGCAAAAAAGGCCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGAT
GGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATCTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGC
CGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATTCAGGTAGCAGGACCCTAGATCCAGT
CGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAGGGTCTCTAGTTTGCGCCAAGTGGACGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGAT
CTACAAAGGGGAGAGACACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTAAACCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCT
GTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTG
GTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATAAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCT
CGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCA
CGCTGGCAGGTTGTTTGGTGTATTGATTTGACATCTGGGTTGGAGATCTCGCTGGTCAAGACGACATCCTCGGGATGGAATTCATGGTACCGGCCGGAGT
GAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCAAAAATGAGGATCATA
AGGGAGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGCG
AGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGA
GATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTATGAG
GCGACTACCGAGATCGAATCGCTCGGAGAAGTGGAGCTATCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCC
TGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAGGTTAAATCCAGGACGGGGAACGATCCCCAGAGTCGGTCCTTAGATAACGCAGGGTCGGTGGA
TGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACGAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGA
GTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTTTTCCTGATACCAGGGTACCTGATTCGC
CGAAGACAGAAGGACTGCCAGGCGAAAGAAGTCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAACAAGTCTGCTACCGTGAAGG
CGGGGATCTACACGCCGAAGATCTTGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGAT
CCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGCCAGAAAATCTAGGAACGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCGCGCTG
CCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGC
CTGCTGCAAGCCAAGATCATCGGTTTCTTAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTG
ATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTC
TCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGG
ATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGAT
CCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGCCGG
CGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGAT
GCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGCTAGCCGATTTGTCCTTCCCGCAGTCG
TTACGGGCGATGCAATCCTTCTTTGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGG
TAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGAATCCAAGTGGTACGAC
GCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCA
GAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGATCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTA
CGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCACGGACACTGA
AGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAG