Description :
From Genome Similarity Track
Location :
Scaffold_1042:2280- 3668
Transcript NameFunction/comments
Phyke_g11942hypothetical protein

Sequence
1388 bases(100 bases per row)
TGCTCGTGCTGNGCattgatcttctcctgcgTCTGCGCGTCGAAGGGCTTCATGTctgacagcaacatcttcgcCTCTGTGGCGTACCCGCTGAGCGCCT
TGCTGACCTTGTGGCCCTCTCGACTCGTGTTGAAAATGTAATTGAATCCCTTGTTTTTTGTGCTCATGCTCCAGGCACCACGGTCGAAGATCTAGCGGTA
GGTGAGGCCGTCAAATTCATTGACGTGCTGAGCTCCACCATGGCGGAAAGAGTGCGATGTCAGCGCGGTTTGAACACTAGCCAGCTACACGGCCAAGGAT
GTGGTTGACGTGCGTGTAGATCGTCGGTGTCGTGTCGCCATCCtaagatgcagcaacagcctcTGCGCCAGTAGCGGTGTCGCTGGAGACAGcgtgacag
cagcttggatCGACAGCACGGGGAGGTTGCCCAGCAGGTTGACACACGGAGCAGCTTGGGCGGTGAGCGCTAACGCGATCACGTACAGCGGGCAGGTAAT
GAAGTCGGCGTCCGGAAACAGCGACAGTCCATGCTGTTCAGCCATCTTGATGCGgatgaagcgcacgaagAGCATGTCGGCTGCATCGATGGAGAGGTTC
TCTTTACGGACCAGCGACAGGTCTGATACCCGCCCGAATAGGTACCACAACAGACACAGCAAGGCAGCGTCCTGGTAGTCACTCGACGTACATGCATTCT
TATACAAATACAGCATCATTTTTTCAAGTCGCTCTTTGAACATGGTGGAACCTTGTTAACTACTTTTCCATCCCGTTTCATACAAAAGTTTTCCAGCGTC
TTCTCTATACTAAGCAACTTTGCTTCGACTATGTGTCGTTGCATGAGGAAGAGCTTAAATAGCTACATCTTACTCTGCCTGTAGTATTGCATGGAGGTGT
TCCGGGCAAGTGGCTTGCCTTTCTTACCCTCGTTAAATGCAAGATGCATACCAAACTTGTCCAATACAGATACAAAACATTGCCCAgtggcatcacgctc
aatAGATTCCTTCACATATTCAAACTCCACACCTTCATTCTTAACAAAAGTCTTAAACACATTGATGGCAGTTGCCTTAGCTCACCTGGTGTTACCAGGC
TTGATCTCTTTTAATCCCATCCTTTGTCGGACAAGCTGCAAATATGCAAGTGATACGTTCGTCACTTGGAGTTTGAGTGAGCATGCACATATTTTACGCG
CACCTCCGACCTGATACGTCGGAACAGTTGTCTTAGAGGACCCACCTAACCCTATATAAATTTATTGGTTGAAACGTACTGGCAAGTTGATTCGGATTGG
TAAAAAAATAATTAAAACAATTTGATTGGCCTCCGATGTGGTATAAAAGCATTAAGTATGGCCGGATAAGTAACGATATTCATCCATA