Description :
From Genome Similarity Track
Location :
Scaffold_2207:228- 4261
Transcript NameFunction/comments
Phyta_totarag14244Eukaryotic/viral aspartic protease, active site

Sequence
4033 bases(100 bases per row)
GGTGCGATCTCTTCCAGGACGGTATCCACGAAGGCTCTGGGTGTGATGCTCGTGACTAGCACCCCGAGTatctcttcttctccctTCGTGGACCGACGAA
TCTCTAGCGCCCATGGTGAGAGTATGGCGACCCATTGCGACAGTCGACCTTGTAGCCCTTTGGATCGGAGCAACCACGCCAATGTCGTGTGACGGGTCAA
GACGCGTATCGATTTCCCAGCCAGCATCGTGAAACAGTTATTGAGGATGTGCAGCAAGGCCAggatctccttctcgacgatgTCATAGTTCAGCTAGTTA
GGCTTCAACGGGCGACTGGTGAATTTCACCAGCATGTACACGCCGTCGTGAGCTTGGGGTGAGGACAGCCGAGATCGCCCAGTCGCTGGCGTACACGATT
ACGACGGGCTCTCGGGCTAAGTCGTAGTGCTTCAACATCGGGGTCTCGGCGATCTTGGGCTTGAGGGCCTCGAACGCACGTGATGCGTGTCTCCACTTTT
CTTGTTCGCGGATTTCCGGGTTCGCGACGTATTCGTCGAAGTCGGTCTCTGTGAGCGAGTACAACGTGGTTGCGTAGATCGTGAAGTCAACGAGAACCGG
TGGTAGTAGTTGAGACTGCCCAAGAAAGACTGCAAGCCTTTGAGTGTACGCGGGAATTCCAAGCTCGTGAGCGACTCCAGATTCTTCGGCTTCTCTTCCA
ACCCGTGCTCCGACACCTTGTGACCCAGGTAGTTAACCTGATACATTCCCCACGTACTCTTCTCCACACTGATGGACAAGTGTCATTGCTCGCAGACGTC
CAGCAGGCGTTCCACCTTCTTGAACAAGTCGTCCCATGACGTGCCACCAATCAAAATATCATCGATGTACGATCGACGGTCTAGAATGGAGTGGATCCCC
GGAAGTTCCGGCTTTCCTCCGTCGAAGACGTCCCGTGTATTTCGATCTGTAATCAAGTTCCAGAAGCCGTAGAGCGTATTGTCGCTCTGTCGCGTTGCAC
AGTCTGAACGACATCCGCAGCCATTCGAACAGCCCAAACGGGGTGATGAACGCCGAGATTAGTCGGGCCCGATCTGTCATGGGGACTACCCAGAACCCGC
TGGCCATGTCGAGGGAGCAGTACCAGAGGTACTTTCCAAGTCTTCCAGCAAGTCGTTGACGAGCGGCATCGGATACACCATCAGCTGCGTCAGTCCGTTT
ACCAGTCTGTAGGCAATGCAGAACCGGATGTCGACCCCATTCTTCTTCACAATCACGACGATGGGCGATAACCACGGAGAAGTCGACAATCGGATCATGC
CCGCGCTGAGGATCCATTTGAACAGGTCGGAGaccttctccttgaactgATGTGGGAGCTTACGGACGCGTTGCGCGATCGGTTTagcgtcgacgacatc
gatgTCGCAGACGACCCCCATGGCCGCGGACGGTGATGCATTGCCCTTCCCGATCGGCCATTTGCGTCGCTTCCAAATGATCTGGCGCAGCCAGTCTTCT
TCCTTCGCAGCCACCTCTGGTGTTACCCCGGTTGGACTTCCGACTTTGAGATCTTCGATCTTCACTTCAGCGATCAGAGTGAGATCTGGCAGAACGGCCA
TTTCCCCCTCCAATTCTTCTGCAAAGAGGTCCGAACCTTCGTGAAAGAGTACAGCGTCGTCAGCCTCAACGACTCGTCTGGCCCATCCTCTGCGGTATCC
ACTGGCATCTGATTCGCCGGTTCTGCAGCCGTCACCCGCGCAACCACCGCAACTGCAGCGACCGCTGGGGACGACTTCGCTGGCGCTCTACTTGGTCTTC
CGTCTTCCTTTCGCCTCGACGCATGATTCCTCGGGGAATTTCATATGTCGGGCGCTCGGTCATCGGTCCGTCGGTTTCGACGGACGTCCAGTCATCGTCC
GCGTCGCAGGTGGCACCGTACGCGAGGTTCTGCCACTCTTGATAGCGTCGCGACTCAACTTGTACGAAGCCGAAGGGCGTCGACGGGCGTCCACCAGCCC
AGCGTCATGTGGGCGTCGAGCGTTATTGGCTTGTCGATATTGGTCACCCGCAGGTACGTTCGCCGCCCgatcttgctcttcatgAAAGTGCTCACCCATG
CCTTTCCTCGTGTAACCCATAGTCGCGGAGCATTCCGGTCTGGCCGTAGTTGAACGTCGTGCGTTCGCCCCgggtcgatcttctcgagcgACGTCAGAGT
GATCGGGTGTATCTTCGAACCGTACAGCGGTCTTTTTCCGATCATCTGGATCTGCACCTCGCCGGGCAGGCACCGTGAAGTTCATGCCCAAGATCGCGTG
CTGGCCCACCAGGTCTCCGACCCAAATGTCCAGCCAGGAAGTAGACCAAGTTCCCCGCTAAGGTAATTTTGATCAGTGTCTTCTCCACCGTGTAGTACGT
TTCGTCGCGGATTCCTACACAATTCTGCGTTATGTCCGTGTCGATCAGGCGGCCTACCTCACGAGCAAAGGTGATGTCCAGTATGGACACCTCGGCACCT
GtatcgagcagcaacgtaGCACGACGGTTGTTCAACTTCCCGTAGGTCTTGACCTGTGGATACCATCTGTCCGGCGCGTAGTACTTCCAGTATCCGCGTC
GTTCCCCAGGCTGCAGGGCGATCCCGTCCAGCGGCGGCTCTCGCGCGTGCTCGTCCGGGAGTCGAATGTCCAAGACTCGGGAAACCCGTTCTCGCGAGGC
ACGTTGCAGGTTGGATTCAGATGTATTATCGATCGGGGTATTCGAGTCTTCACTAACCACCTTTTGCGACTTCTTGGTCACATATGCATAGACAGAAACA
GGTCACTCGTCTCGTTCTGGTTCCAAGCCAACGAGCGATCTAGCACAACATCTTTTCAGCCGCCGGTGGCAGCATTCCAGCATGCTTCTGCGGGTCATAC
AACTGGCGAGGCTGGTTGAAGAATTCCTCCATGGATCATTCTCCGGCTTCGTGCACATTCCCACTAGCTCGACACGCACGTAGGCATCGGTCGGTTGGGT
GATGGTCACTGCACTTCTGACAGGTCAATATGCTCCAGCAATCTCCGTCTGAGTGACGGTACGACTTGCAATGGCGGCATCGCGGCTTGTCTCGCCCCAA
GTCATCCGTGTCAACGTTACGACGTGCGTTCTTGTCCGGCAGCACTTGACCCGTCACAAACAGCTTGGCccgctcttcgtcgtctcgATCTTGATCGTAC
ATCTGATCGTCGTAGCCGCGGTCATCGCGCCCCGAGTCGTACCCGTCCGACGTGACTTGGACCGCGTGAACCGCGCGTGTCAGCGGCGTCGGTGTCGACG
CCTTCTGACGGGACTTGCTAGATCCAACAaggtcttcttctggtggGCGAGTCCACGCTGCCGAGCGCGTAGCTTTTTCTCCAGCGCAACGATATCCGTC
ACTTCCATCAAGGTGAGTCGAGAGGCcagttcttgttcttgtgaACCGAGGATGTTGATGAATAACTCCACGTGCTCTCGTTTCTCCTCCTTTGTACCAT
CAGCGTAGTGGATCTTGGCCCGCATTCCCGCGACGTTGAGTCGATACAGGTACTCCAACGGAGTCTCATCGGGATGCTTGTTGGCATGGTAATACCGACT
CACCATAGACACGCCCTTGCCGCAGTACTGGATGTGGAATTGCTCCGTCAGATCTGTCCACGACTTCGTGACATCTCGGCCCAGCTGAAGGTACCATTGG
CGCGCGGGTCCGGTCATCAAGTCACTGAACATGGCGCACACTTCGTCACCGGTCATGCCGTCACGGCGCGGACTTCACGCGGTTGAGCCAGGTCCGGGTT
TTCTCTTCGCTGGAGTCTCTACCGTGGAACCTTTTCAACTCCGAGAACGCGGAGAGGCGTACGCGGGTGACAGCGACTCCAGCGGTGCCGGCGGTCGTGG
CCGAGATAGTGGCTGCGTTCCCGGGCGTACCGGGATCCAGGTCGAACAGATCGTCCGGGCCCTCGTCTAGGTTGCGTCGAAGACGCGGAGATCGCGACGT
GGAGTGTGAACTCACCAACTCCatggccacgtc