Description :
From Genome Similarity Track
Location :
Scaffold_3637:228- 1789
Sequence
1561 bases(100 bases per row)
GTCGAGTTGTCGCCAGAAACACTGAAAGCGTTTCAGGCTGGATATCGAAAGGATCCTGACTTCAAGCACTTCTGGGCATCAGACGCACAGGAAAACACAG
ACGTGGTAAAATGCGACGGTCTCATCTTCGTCAAGTCTGTCAACAATGTGAAACGCCTGTGTGTACCGTCTGATGATCGTCTTCGCACGCAGATCATCTC
AGAATATCATGACTCACCCATCGCTACTCATCCCGGAAGTCGTCGCACATTCCTGCGCATTGCGCAGTGGTACTTCTGGAAAACGATGTAACGAGACATC
AAGGACTACGTCAGATTATGCGACATGCGCAAGATGGAAGCACGACAACCAGCGCAAGAACGGCCTGGTCATGCCGATACCAATTCCCGAACAGTGTTGG
CAAGTCGTCACGATGGACTTCATCACAGGGCTTCCTGTCTCCAACGGTTACGACGCCATCCTGACCGTTGTCGACAAGCTCTCGAAACGCGCTAAGTATG
CAGCCGTTCACAAGAATGATGATGCGCCTGACACAGCAAAAGTCTTCTTCGACACCGTGGTACGCCATCACGGTCTTCCCGAAGTGATCATCAGTGATCG
AGACAGCAAGTTCACTTCGAGTTTCTGGAAGTCGCTCATGAAACTAATGGGTATCCGTCTGAGCATGACGACAGCACATCCCGCACAAGCTGATGGGCAA
ATTGAACGCCAGAACCTCGTCATCGAAGATGCGCTTCGTTGTATGGTGTCATACCAAGGAACAGATTGGTCAGAACACCTTGGCACCATCGAATACGCTC
ACGCAACACTCGTAAGCGCCTCGACTCGCTTCTCCCCTTTCATGATCGATACGGGAAGGAAGGAACGCAACATCTGGGAAGGAACGATCAATCCCCATGC
TGCAGAGAAAGGCATGGCCGAACACGCAAAGATCTTTGCCGAAGAAAAGCAAAAGATCGTTGAACGCGCCCGGAACAACCTGCTCAAATCGCAGGCTACG
CAGGAGAAGTATTACGACAGCAAGCGCCGCGTTCATCAGATCCAGTTCGGACCCGGAGATCTCGTCATGATGGACACAAGCCGGCTCTCGCTTCAACATG
CCGCACAAGATGCAGAAATGAAACGCGCCAAGCTCGCGGCGCGCAAGATTGGCCCGTTTGAGATCCTCAAGATGGTCAACCCAAACGTAGCTCGACTCAA
GCTACCAAAGTCAATGAATCGAATGAATCCGACATTCAACGTCGACATACTGTCTCCCTACGTCCCAACGCCGAGGAAATTCCTCAGCCGTCCAATCCCA
AAGACATCCAAGTTCGTCATGGACGAAAAGTCGAACCCGATGCAAATCATCGAGAAGCTCCTCAAGTTTCGCACGTTCAACCGCCAAGCCGAGTGGCTCG
TTCTGTGGCACGGCGAAACAGAAGAACAAGCAACATGGGAACGCGAACGCAGTATCCGTCATGTTGTGCATTGGAAAGAACTCGTGGCTGACTTCAAGAA
GCGCCAACGAGAACTCAAATCGGGGAGGATGTAAGGACGCATAGCACATGCACACGCCCCA