Description :
From Genome Similarity Track
Location :
Scaffold_2272:228- 1332
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2272-snap-gene-0.0Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_2272-snap-gene-0.1Conserved gene of unknown function

Sequence
1104 bases(100 bases per row)
AAGCCTCTGTTCTTTCGTCGCTGGAGATCTTTGACTCGAGCACACAAGAACAGATTAGAGAGATCAGCCACAAGTTCTTCAATGAGAGCCATGCGTTGGG
TAATAACGCCTTCAATGTCTGCGCTGCTGTGAGAGACGTGCTGACAGTAACCATCATCCTCCACTACCCGTTGCTGATGAAGACCAACCTGCAGGGACCT
GCGATGACGACGATCAAGCGCTGCACCGAGGCATCCGGTGTGACGACGTCGAACCTGCTCGCATGGTCTCAGCAACTCACGAGGTCAACTGCTCACGCAC
ACACTTCCGCGGAAGACCTGACAGAAGGAAACGTGAAGGCCAAAGTTGTGTTCGATCATCAGACTGCCTTGATTGAAAGGTTAATCGAGGTCAACCGTCG
CCTCGAGGCTTGAGTCAACTCGCTAGAAGCTGCATACAGCAACAATGGAGAGAGCACACCAGCAAACCATGGCGATCAAGCAAAGCGACCGAGAGACGAA
AATGAAAGCGTGCCGGCGAAGCGCCGATGCCGATCGAAGACTATACCTCTGGTCGACGCCTGGTTCGCGTGGTACACGGCGGTTCCGCGCGGATGGCTGA
GTACTAACAAGCACAAGAAGTCAGACGCCAAGTAGCTCGTGGCCTTCATGACGCTCTTCATCGAAGATGGATACGCACTCGACGAGTCATCGCCCAGCTA
CAAGGATGACGTTCGTCAGCTTGGAGAGCAAGCGTCGAACGAAGTCATAGCGTACCTGCACGCGCGGAACGTACCGTCAACGGGATCCAATGCTGTGCTC
AAGGCGCTTCGGCAGCTGCATCGCAAGGGAAGCCTCAATGACCTCATCAGCGCCTATCGCCAGCGCCTCGCCATCGGTAGAGTTGTAGATCCTGCACCAT
TTCTTCACCAAGGCACACTCATGCCGCATCCGTAATTCACACAACACGCACCGCACCCATGCCGTTTGAAGTCGCCTTCCTCGCCCGTGTCCTTGTGGTC
GGTGCTCTTTCTGTAGTTGTCGCTTGCTTGTAGGTCTGCCTCAGTCGTTCAAGCATAGAGAAATATACCGATGGGTGGAATCGAACCCTCTCAAAATAGC
TCAT