Description :
From Genome Similarity Track
Location :
scaffold_30:227946- 230613
Transcript NameFunction/comments
g2298.t1hypothetical protein

Sequence
2667 bases(100 bases per row)
AATAAATTTTACTATTCTACGCTAACTATTTGCTAAATCTCAACTCACATTGAGCACAGCAGTGAGCCGCATACTACCCTGAGTAGACTGAGGGACCCAC
AGCAACAACGAACCACCTCCTGTACCGGGGAGACCCATAAAACCCGGACGCCACCGATCCAAATACAGCGTCTTGCCTCCCAGCCTCGTCACATTTGATT
TCCACATCACGGTCTGTCCAGCTGGAACGGGTACCTCGGCGACCTTGTCGCCGCCAGACTTGATGTTCACAGACACATCCTCGGTGTCAACGCTCTTGAA
TGTGACGATGACAGTTCCGTCGCCCTCCTTCTTCCACAAGCCGTCACTATTATTGAAGGCATCTTGCACAATTGTCATACCCAATGCTTTCTCCGCTGTA
CCGTCATCAATCTCACCGATGAGCTGTGTTGGGCCACAAATCGGCTGGAAAAACTCGGAAACAATGCCCGTGACAACCCACATATCCCAAATGGCATAAA
ATCCAAGGGCTTTGTCCGCAACCTTGAAAGCGTATTCCTTAGCACTAAGGAAGGTGCCATTGCTGCTCGTTCCTGAGCTGATCAGATCATCCATGATGCT
TGCAAACGTCTTGCGAAGGGTGTCGCGTGTGGCGTAGGCTGTTTTTTCGTCCGAATCCGCGATCAAATCGTTCATACAGTTGTTTGTCGCGATGGGGATA
TCCTTCAGCACCAGGTTCGATTGACTCATGGCCACGCGAATGTCATCTTCGGACATTCCCGGATTCGTTTTAAGCAATTCAGCCACGGTCATCCATGTGC
GATCCAACAGGCGCTTCATATCATATCCACAGGTGGAGTTGGACTCCATCGCGGACTTCAAACTGGTGATGTCGAACTGGTTTAACGAGCTGATCGATTC
ACCGAGCGTGATGTTCTTCATGAACGATTCGAAATTGTCCCAACTTGAAACAATAGTATCGGAGTTTTTGACGGCTTCTCTCAGAATGAACTCTGCCGTT
GTGAGCACTCTGTCTGCAAACTTGACGCTGTCAGACACTTTGATCCCAAGACAGTAGGCTACTGCTACGGGTATGTCAATAACCACGTTGTCCGTCTGGT
AGAGCACTGCAAGAATCTTGTCTTGTGTTGACTCGGGGTCAGACACCTTGGCGTAGCGGATGTACTTGACCAGTGACTTGGTCAAACCCAGCATGCTCTT
AACGCACTTGAAGGCCTGCTGAATCCCTTTTGCCACTTTATAGAAAGCGCCGAAAAGATTCATCGTGACGAAGGACATTGTCGATTGAACCACCGTTCCA
ACCTTGTAAGCAACTTCCAAAGCACAGTCGTCGTTCTGCCGGATGCACTCCAAACCGCATTCGACGGGGTACGAATACGGACACTGCGCCCAACACATCC
CATGTTCGCTGTTGAATCCGAGCGGACACGTCTTCGCAATGTGAGACTCTCGATAACACACCGAGGTGAATGAAGTGTCGAGCTCGGAGCCGACCCAGTT
GACGTACGTTGCCTCGATCGTACTGGTAGCGTTCATCACACTACCCGTCGTGAAAGCCACGCTCATGGCGTTCGAGGAAGCAGAAAAATCACTCGACCCG
GAGCCAGATACAGTTGAAGGCACGTCGTCGTCGCTGTCACTCGCTTCGTTAGGACTAGTTTCAGATCCATCTTCATCATGTTCGTCACTGCTTGAAGAAA
GTGCGGCTTGAATTACGCTGTCGGTTGAGTCTGCATCATCGCTGTCTAGAGAATCGTTGTCACTTCCCGATGACTTGAAAGAGATCTTGGTGGACGTCAA
CGCGCCAACGTCCGTGATATTGTCAATGTCAATAGCGGCCGTCACTGTAGCAAGCGGAGTTGACGTCCTTGGCCACTCGTCCAGTGTTAGGATCTTCGCC
GAAGCGATTCCAACAAGTAATGCAGCGAAGACGGACAAGAGCATTGTCACCCTGGCCATCTGGATGGGTCTCGCGTCAGCGAGGAAGCTTGTTGAGCCTC
AAGTGGGACGAAACAAAGAATGAGGTGGTCGAGAGTGAATTGTTGAAACCTGCTCTCCGAAAACGAGTTTCTTTGTTGCAGTGTTTGTTGGTTACCGGTA
CTGGACAAACGATCTTGTGCTGTGTCGGGTCACAACGGAGGGCGACTGCCCCGATTTCGCCAGATGAGCATACCGTGTTGTAAATCAGTTCCGGTGGACA
TGTACGTGTACTGCAGCGTGGTACTTCCCGTCTTCAACAATGCCACAGCAAATTCTTCCAATCATGCCCAAACCGTCCGCGGACTAGCACAGCTCGGCGC
CATCCTACCATCTGCCTGCGGAGATACGACCACGCCGCGTGCGTCATGGATACTTTGTGATGCTCTCCTCCAGTCGCCTCCCCAGCGTTCCTGCTTGCTC
AAAATATCTCCTGTGTAAACTCAACGAGAGACGCCACATCTTGTGACGTGGGGTCTGTCGAGATCTGAACGGGGATTGGCATGCCCGTTCTCAAAAACGA
TGAGGCGCGTAGATTAGCTCGCAGTCGCAAATTGCGACCCGCAAACGCGTGGATTGCCAGTGGTTTGCTGCGGCTGCTACATGTACATGTACAAGATTTC
GTGGTGCTGTTGTGGGAGCGTGTTGCCGATTTGCGTTGACCTTTCCGCTGTTCGATAGCCAGCTCGA