Description :
From Genome Similarity Track
Location :
Scaffold_65:227945- 234962
Transcript NameFunction/comments
Hyaar_Emoy2807554PREDICTED: exostosin-3-like
Hyaar_Emoy2807555myosinlike protein putative
Hyaar_Emoy2807556NADPH:adrenodoxin oxidoreductase, putative
Hyaar_Emoy2807557NADPH:adrenodoxin oxidoreductase, putative

Sequence
7017 bases(100 bases per row)
ATTCTTGTTCTATCCCGTAAGTGACGTGTGTTGCAGCATGACATCGGCCTCAGAGCTCCGTGCCCAGAACGAGCACTTGACGCGTGAGGTCCACGCACTA
CTTCGCCTCAACACGGTGCTCGAGATCGAGGCGAAGGAGCTCGAAAGCGAGTGTAGTACACTGCAGTCGATTGGCATTGACAAGGTGGAGACCCTGGAGC
ACGAGCTCAAGACAATGGACGAAGAGCTCACGTCACTGCAGTCGCAGTGTGAGTCCATAACGGAGATCATTGAAAAGGCATGTACTGAGAAGGAGGTCGG
GGGCAAGCTGTCGCCCGCTATTCTCTACACAATTCAGCGCGTCCGATGCATGACAATGCCTCGGCAAGAACGGGCGTCGTCATTCATGGTATACACTAGC
ATTCCCAAAGCTGCGAGCTTCACGGTCTCAGCATCCGACAAAATGACTCTGGACGGCCCTAAGATGCACAAGGACAGTCCTCCCATTTTGTCGTACGCGA
ACGCCGCATCCGGCGCCTTTAGAAGTCTGATCTTTACGACCCACTCGCACTACGGGAATTTCCGGAAACGCAGCGCTCGCAAGCATGACGACATCGAAGT
GATCTAAAAAATGCTTTGGTCGCATTGCGGGTCACTGCGAGGAGGTGCCGATAGAAGGTGAACCTACCTACGTGTATATCCAATATTTACTATCGTGTCG
GCCTCGCAGATCCGAGTAATCGAGAGTTGAGTCGCGTACGTACGACTCCTTGCTAATTAATTACCTACCGCCGGGCGATCTGTTCTTAGCTTTCGACTGA
CAGAAAGAGTGAGACGACGATAGTTTGCGTACGCGCTCAGGCGGTAGTTTATGAATGTCCCTCAATAGATGTTATCATATTTGTCCAGTTTACATGAAGT
GCTGGTCAGTTATTCACCCGCTTTCACCTTCGTGTCCCTGTTGCGGTCAAGTGTGCCCAATAAAGTTTATATACGTTTATTATGAATGACAACACCACTT
GAAATAGAGAAGTGTCACGCGTTTCAAAGCATCTGAGTGACACCACGTTTGCAGTCGTGCTGTCGTCTGTCATCGCATCTCGCGGTCTAGTTACAGCCCG
CTCGCTGACTTCTGACGCGCTAGCTTCTGGGCCTTCACCGAGGCTAGTGTAGGGCGCTCGAACTGAGACTTGCCGAGCTTGCGGTTCACATAGTACACGC
GGCCCGTTGAGCGGGACACCTTGGCCTCCCAGCCAACAGGCAGGGATACCTCGGGCAGCGCATCCAGGTTGAACGACTCGCGCACAGGGCGATCCGCTGG
CTTTGCAGGCGGTGGCTTCACTTTCCCACTACTCGCACTACTCGAGGTACTGACCGTCGCGGACGGGACGCTGTCAGACGTGCCCGCTGTCTCCTCCGGC
TTGCTGTTCGTCCGCTTACTTCGAGAATCATACATGCCCTTCACGACCGACATGCGACCCTTCAGACTCGACATGGCTCCCGTCACACCCACCTCGACGC
TTTTCACTATCGTGTTGCGCGCAGAGCTGTCCGTCGGGCTATCCTCACCTTCGACCTCCGAAACGTCAAAGCCGTCGCCGTTAACACCCTTCTTGTTATT
CCAGAAGCGGGTGCCTACGCTCATCGTTGGCATGCGAGGGAAATGGCGCTCTGACTGACGCGTCTCCGACGTACGACTGTTAAGGTCGTCCGAACCAGTA
AGTGAGTCCATCAGCACGGTCTCACGAGGCTTCTTCTCCTTCTTGGACCCCAGCGTACGGAAGATGGACTTCTTCTGCGTTGACTTCTTCTCAGGCACAC
CGTCCACGTAAATCTTTGCAAGTTGCTCCACGAGCTTCTTGTTGTCGGTCTCGAGCAACTTGATCTTCTTGTCTTTCTCGCGCACCGTGTCCTGCAGCTG
ACGAAGCTTGACGTGATTGCCAGCCGACGAGAATTCTTTGTCACTCTTGAATTTTTCAATCTCGACCTTCAAACCCTTCATCGCAACCTTCATTTCTACA
TTCTTCTCACGCAACTTCTTATTCTCATTCGTAAGAGTTTCAATCATGCCACCAGCGTCAGCCATCACCACGCTCGAGGCGGCAGTTGTATCCGCCGTCG
TCACACTACTACGACGTTGTAGCTGCACATTCCTTTCCTGCTCTTCTTGCAGAGCGGCCTTCAACTTATTCAGTTGGTACGCCATATCAGCCTCACGACG
TTTCTCGTCGAGGGCAGCGAGGTATTTTGGCCTCTGAATCGTCATTCGAACCACGGCTTGAACACGAATGACCATCGCCCGCATGTTAACGTAACTATGA
CGCTTGACAAAGCCGCGCACATACCGCTGAATGATGACAGCGTAGTGGTTGCTCTTGACTTCTGCAGCTACCTTTCGACCTTGATAACCTCGCCAGTGGG
CCTGCATCAAAATGAGGCCGTTCATAAATGTGTTGTACCTTCGCATAGCAATCACACATCGGATAACTGATTGAAGCTTGATAATCGCAGCCAGTTGTCG
GAGGTACTTGATACGCTGCGTGAAGCCAAGCATGACATTTTGCAAGTACGTCGCCTTCGCATCCAGAAATTTCTTACGACGATCTTCGAGCTCTTCAAGC
ACACCCAATTGGAAGTATACCCGGGTCTTACCCATCTGGTATTGCACTGGAGACTCTATTTTCAGCTTGTCCATGAGTAGTTGACATTTTTCGACCGGAG
TATTACCACCGCTTGGTACAAAGAGCCAAAACTTGTCCAGAATCTCTGTGTGCTGCAACCGATTCGGGTACGCTGCACGTGAGATACGAATAGCTTCAAT
TACACCTGCACATCGCAGTTGAGAGACCACCATGGACTGATCCATGACTGTAGAGCTCTTAATCGGGTTGGGCTTGATGCAACGCACGTAGTGAACTTGG
GTGGAGTTGATCGTCGCCATCAGCTCTGTTAAGCTCTCTTTGAACTGAGTACCGACAGTCGTGATGGACAAAGCACCGCCACGCTTCCGGCGACCTCCCG
ACGCCTCAGAAGCAGCGGTCTTGGGCTCCGGCTTCGGTTCAAAGAGCTCCGCGATGAATGGCTTTGACGAACCACGCATGAGCTCGGATAGGTCAGGCAG
CAGCGAATCCTTGTGTTTTTCCAGAAAGCCCACCGAATCATACATGACCGGAGCAGCATAGTGCTTGATAAGAAACTCGGTACGAGACGTGCGGGGAAAC
TCAATCACGTGTGTCATGTCATCCTTGTGCAGAGATGTCACCTTGGACATGAACGACTCCTCGCTACCCTTCGGTCGCATCACCTCTTCGTTCAATAAGG
AAATAATACCCATGCGCGACTCAATCACGGTCAGCACGTCTTGGTTGTCCGCATACTCAATGTGGTCCCACACGATACCTTCTTCCTCATACTCAATCTG
GACAGTCTTGAACACATCCTGAGTAAACTTCTGTTGCAACTTTTCGTTAGCGTAATTAATGCAAAACTGCTCGAACGAGTTGTGCTTGAAATGCTCGAAA
CCGAAAATATCGAGCACACCGACGTGATTCGACATATTCTTATCATCAGCGAGAGAGTGATTGATTGTCGTCACGAGCCAGTCGAACACATTCGAGTAAA
TAGCCTTTGCCAGGGCATCACGACAGTTCATCGCCAGCTCTTTCTTCAGTGGCACACTGTACACATCGTTCACCGCGCGCATGGTACGCGAACACAGCGC
AGTCTCAAGTGCTTCCCATGTGACGCCCAGCATCGCAGTCGCCGAGATCGCGCCACCATCACCCACAGCGATATTCGATTTCTCATCGTCCGATGCGTCG
GATAGCAACTGCACTTCACCAAGGTGCAGCACGCCCGCCAGCACTTCAAACAGTGGCTGCTGCTCTTCACGTGAGAGTCCCACGAGCGCCAGTGCCTCTC
GTGTCTTGATAAAGTGCTTCTCGTCCGACAATCCTTCAATCTTTTGCGCCGTGTTGTTGCCCGTGTACACATAATGTTTCGTCGAGTCGAGCTGGAGCTC
TGCCGCCATGTCGGGCGAGTCCAAGAGCTGGTAAAAGATATGGTAATTGCGCTCCGGGGCTTCGTGCTGGATCACACGTGTCTTCTCCAAGAGATACGTG
CGACACTTGGCGCCCACGAGCGTGCCCCTCTGGTCAAACTGGAGCTGTGTAAACTTGCCGAATCGACTCGAGTTGTCGTTGCGGACGGTCTTGGCATTGC
CAAACGACTCGAGCAGTGGATTGACTTCTATAATGCGCTTGATCGTCGAGTTGTTCATGCCGCCCGCGATCGTCGCGAGGTGGTTCATGAGGATCTTGGT
CGTCTCGGTCTTGCCCGCTCCCGACTCGCCACTCACGAGGATCGACTGGTTCCACTCGGAGCGTCGCATATTGTCATAAGCAGCGACAGATGTCGCATAC
ACGTGGGGCGGGAGCTCTTCCTTGGGTTGATTCAAGTACCGTCGGTGCTGCTCCTCGGCGTAGAGCTCCGGGAGCCACTTGTACGGGTTAATGGCGATAC
AAATGTCGCCCGTATACGTATACGGGAGCTCGCATAAAAAGCGCTTTTTAATGTTGTACAGAATCGCCGCCTCGTGCAGGTAATTGAGCGTAATCATGTC
TTCAATGCCCTCAGACCCGACGTTCTCGTTCTGATACGGCAGCGTCTCGAGCTCGTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGCCAGCATGTCCACG
CAGCGCTCTTCCGTGCCGCCATCCGGGAGCTCCACTCTGCAGTAGATCTTGCGCGTCTTGCCGTCGCCCGAGTTCTCGTCCCGCAGGACTTGGGCGGCCA
GCCACACGTGCGTCTCGTCGGGGACGAAGCACTTGGCACCGACGACCATCTGGAGGTCGTTCATCGTGTGGGAGTGGAAGTGGTCGCAAGGGGGAGAGCA
GGAGAAGAAGAGGAAGAGGGAGGAGAGGGGGAGAGAGAGGAGAGGGGGGGCGAAAGCGGAATGCCGAGGCGGCGGATTAGATAGATATACCGGTAGATCA
AGTGGGTTGCCAAGTAGCAACGGATGGACTGGAGGTTAGACTGTGGACTCGGATTGCGCAACCAGCTGGTACGGACAGCGCCGGGACGACGCAGCTGCTG
CGAGAAGATTTGAAGGCGAAGCTCAAGCTGAGACTGGAGGTTGGTTCAAAGGCTGGACTGGACTGAACTATGCTATGACTCTGTATGAGAGTGCCACGTT
TACGTTGATGCGTCGCGTCTCTTTAGACTACTGAAATTGCGGCTTGTGCAATGCGTGACACGTATTCTAGTGAGTGCACTTTGTAAACGTCTTTTAGTAC
CATTGAGGGTAACAATGAACGTCCTTTTGACAGATAGTGAAAAGCAACCTGGTTTCCCATTGGTCTTTTTCTGCAACGAACATGATTTATCGTGAGGTAA
GCAAACTTGTCGAACCGCATACCGGTTAGTGCACACTGTGGGACAACCTACCGGTATGTAGCAAATACCCTACATCAATCCGAACGACATGCTGCACCGC
TATACCCGGCACTTGACGCGTCGTCAGCGCGTCTCGAGCGCTCGTCAAGTGCGCGGCTTTAGCCTTCACGTCTCTTCTGATGCTCCTCTTCGTCGTGTGT
GTGTAGTTGGATCAGGACCCGCAGGTTTCTACGTCACCAAGTACCTGCTCAAGCAGCACAGAGGCGTACGCGTCAATATGCTCGAGGCGCTACCGACGCC
GTTCGGTCTCGTGCGCTCAGGCGTTGCCCCGGATCATCCAGAAGTGAAAAGTGTCATGAACGACTTTGAGCTCGTGGCTGGTGATGACCGGTTTGGTTTT
CTGGGGAACGTCTGCGTGGGCAAAGACGTGACGCTTGCTGAGCTGCAGCGCTACTACCACGCTGTGATTCTGGCCTACGGCGCAGCAGAAGACAGGGAGC
TGGGCATTCCAGGAGAGCAGCTAAAGGGCGTCCTGTCTGCTCGTGCATTCGTGAACTGGTACAACGGTCATCCAGCGTTTCGTGGACTGACGCCAGACTT
GAAGCGGACGGAGACGGCGGTTATCATTGGTCAAGGCAATGTAGCTGTTGATTGCGCTCGCCTTCTCACAAAGAACGTGGACGAACTGGCTAGGACAGAC
ATTGCGGCTCACGCGGTGCAGGTGCTGCGCAATAGTAGTATTCAGAAGGTGTTCGTGGTCGGACGACGAGGCAGTGCGCAGGCGGCGTTTACGATGAAGG
AGATTCGTGAGCTGACTAAGCTGGATGGTGTTGCGTGTGTTGTCGATCCAGATGATCTGAAGCGAAGCTTTACGCCCGCATCCGAGCAGGAAATCCAGGA
CCAGCGAGCTCGCAAACGCATGGAAGAATTGCTGAGTAGAGCCGCAGAGCAGTTTGAATGCACTCAAAACGCCAAGCGTGTTGTGCAACTCAAGTTTTTG
AGCTCACCAGCGGAAATCATCGCAGACGAGAATGACCCGACTCGAGTGGGAGCCATTCGTCTGGAGAAAACGAAACTAGAGGGCAAGCCCAACCGACAGC
GTGCTGTAGGAACCGGAGTGTATGAAGATATTCCATGCAGCCTTGTGTTGCGCAGTATCGGATACAAGTCACTGCCGATTGAGGCCGGTATCCCATTTGA
CACCCGTCGCCATGTGATTTCAAACGAGCGAGGTCGCGTTGTTTCTACACTCAGCAGTGGTGAGAAGAAGTCTATGGTAGGCTTGTATTGCACCGGCTGG
GTGAAGCGTGGCCCCGCTGGCATTATTGGCAGCAATATTGTCGATGCACGGGAGACGGTAGGGTGCATTATGGAAGACTTTGCTGCTGGGAACTTTCTTC
ACAGCGACGGTAACGCTGGTAACGACTTGGGTGAAGTGGAGGCTGTGGAAATGCTAGTTAAAAAGCGCTATCCTGACAAACAGCTCGTCAAATGGGCTGA
CTATGTGCGCATCAGCGCTGAAGAGACTCTACGGGGTCAAGCCGTCGGGAAGCCGCGCGAGAAGATCACATCCGTGACAGAGATGCTCGCGATCGCAAAA
AGTGCAACGAAGCAGCT