Description :
From Genome Similarity Track
Location :
contig_57:227938- 231599
Transcript NameFunction/comments
g10525.t1XP_002998894.1 ATP-binding Cassette (ABC) Superfamily [Phytophthora infestans T30-4
g10526.t1hypothetical protein

Sequence
3661 bases(100 bases per row)
ACCTGCTTCTTTCAAGTTTGTCAAGCTGTACCGCTTCGCCACAGCTTTTGACAAGGTGCTGCTGACGGTTGGCATTATCACGACGGGGGCCAACGGCGCA
CTGTTCCCTTTGATGGCCATTGTTTTCGGCAACGCGCTGACGGGATTCGCTTCCACGCCAGTGGACATGGACTCGGTGAACAGCGCATCGCTCGACTATT
TGTACATCGCCATCTTCATGTTCTTCACAGATTACGTTTCGTACGTGGCGTTCTACTACAGTGCGGAGAGGCAGATGAAGGCCTTGAGGGTGAGGCTCTC
AACACATGCTGTACATGGACATCAGCTGGTATGACAAGCATGACGCACTGCAGTTGTCGAGTCGGTTAACGGGAGACACGGTGAGAATCAAAGATGGCAT
GGGCCATAAGCTCGGCTACGCAATCCGGTACATGATTCAGTTCATTGTGGGCTTCATCATTGGCTTTGCGCGTGGCTGGGATATCACGTTGGTGATGGCG
TGCGTTATGCCTATCATGGCCATCTCGCTCAGCTGGCTGATTAAGACAATGACAATCATGGCGGAGTTTGCACAGAAGGTGTATGCTGAGGCTGGTTCAG
TCGCAGAGGAGACACTGGGATCGATGCGAACGGTGGCGTCTCTGAACAGTGAACACAAAGCGATTCAGAAGTTTGAGAAGAAGGTGTTTGAGGCGGAGAA
GGAGAATATCGCACTGCACAAGATGTCGGCTGTCGTATTCTCGCTGTTCATAGCAAGTATCTACGTTATGTATTCGGCCGGTCTGTGGTATGGGGGATGG
AAAGCTTCGAAGGAAACACTACACCTGGAGACGTGTTCGCCGCCTTCTTCGGTGTTATGATGGGATCGACTTCGCTTGGCCAGATTTCGCCTAATATCAC
TGCTGTCTCCAAGGCTGCCGGCGCCGGTGAAGAACTCTTCGCTATCCTCGACACTGCCAGTGTCATTGACGCAGAGAAGGAGGGCGAAGGCGTCATCCCT
GACTCCTGAAGGCAAAATTGAAGCCGTGAATGTCAACTTCACGTACCCGAGCCGTCCCGAGGCGCAGATCCTGCGTGACTACAACGTCACCATTGAACCC
GGCCAGACGGTGGCGTTCGCGGGTGCTAGTGGCGGCGGCAAGAGCACTCTCATCGCGCTGATCGAGCGCTTCTACGACCCCACCAGCGGCACGATCTACC
TGGACGGACGTGACGTGAAGACGTTGAACGTCAAGTGGCTGCGCTCGCAGATCGGCATGGTCTCTCAGGAGCCTGTGCTGTTCGCCACCACCATCTTTGA
GAACATTGCTATGGGCGGTGACAACGTGACTCGCGACGAGGCCATCGCCGCGTGCAAGCTGTCGAACGCGCACAACTTCATCATGTCGTTGCCGGAGAGC
TACGATACGTTGGTCGGCGAGAAGGGCGTGTCTCTGTCTGGCGGCCAGAAGCAGCGTGTCGCCATCGCACGTGCCATCGTGCGCAAGCCCAACATTTTGG
TGCTGGACGAGGCCACCAGTGCTCTCGATAACGAAAGCGAGAAGATCGTGCAGGCGGCGCTGAACGACCTCATGGCCACGACGAACATGACGACGTTGGT
GATCGCCCACCGTCTGAGCACGATCCGTCACGCCGACAAGATTGTGGTTCTGAACGAGGGTCACATTGTGGAGAGCGGGACGCACGACGAGTTGCTACAG
ATCGAGCACGGCATTTACCAGAACATGTATCGTATCCAGGAGCTGCGCTCTCATGAGGAGCAGCAGGAGGCCGAGAAGCGCGAGGCGGAGAACGATCTTT
CGGGTACGAAGTTGTCTCGTTCGGTGAGTGCTGTGTCGGCGAAGACGGACATTTCTGTGAGCGAGGTGGAGAAGAACTTCCTGGACAAGAAGCCGTTTGG
CTCACAGATATATTGAAGCTCAACAGATTGGAAGCGAAATACTTCGCTATCGGGATGATCGGGACGGGCGTGGGAGGGATCGTCATGCCAGCGTCTGCAC
TACTGACCACAGGAATGATCATCCATGACGGAACAGTATGGGCTGTACCAAAGGTCTGGCGAAAGATCCCATCTGGCCACAATGTACAACGATGTGAAGC
TGTACGGGATCCTCTTCCTCGTTGCTGCTGCGGTGATCGGGATTTTCATGTACATGCAGATCTATTGCTTCAAGTTCATGGAGGAGAAAGTCACCACGCA
CTTACGTACGGCGAATTTTAGGGGCTTGTGCCGTCAGAATGTTGGCTTTTTCGATGAGAAGGAGAACGCTACGGGTGCATTGACTGCCGACCTTGCCACG
AACGCTACGAAGGTGTCCCTGCTGTCTGGAGAATCGCAATCCGGTGCTTTCCAGGCGGTGTTCACCTTAATTGCTGCTCTCGTCATCTCGTTCGGCTTCG
GCAGTTGGCTACTCACGTTGATCATGGTGGCGCTCATTCCGTTCTTGCTTTTTGGAGAAGTGGCGCGAATGAAAGAGATGGAGACCAGCGGATTGATCTC
GGATGACTTGGCAACCCCTGGTGCTCACGCGTCTGAGGTTCTCAGCAACATTCGCACCGTTGCCGCTCTGGGCATCGAGTACAAATCTGCGAGCGTGTTC
GACGAGCTGCTGCAGGAACCTCTTCGCAAAGGCAAGAAGGAGGCACAGGTCAACGGTCTGTCGCTCGGTTTCAGCTCCTTCATCCTAATGGCGACAAACG
CGCTCATTTTCTGGTTCGGCGCCAAGAAAGTGGACGACAACACAATTACCTTCACGGAAATGATGCGAACGATGATGGCAATCATGATGTCCATTCAGAT
GTCAGCAGTGGGTCTAATTTCTTACGTGATGCCCAAGGCGTTCAAGGCTGGGTCGACCATCTTCGCCATCCGCGATCGAATCGCCCCAATCGACTCGTTC
AGCACCGATGGTCTCCGTTGGCTAAGATTGAGGGTCGACTCGAATTCAAGGACATCTCGTTCCGGTACCCGACGCGTCCCGAGATGAACGTGCTCAAGAA
CTACAACCTCACCGTGGAAGCAGGCCAAACGGTTGCATTCTGTGGCCCGAGCGGTGGCGGAAGAGCACTATCATCTCGCTGATCGAGCGCTTCTACGACC
CTGTAGTCGGTGAGGTGCTGCTCGATGGCCACAATATCAAAGACCTGAACCTGAACTGGCTGCGCAGTCAGATCGGACTGGTCGGACAGGAGCCCACGCT
CTTCATCGGCACCATCGCCGACAACATCTCGTACGGTCTGGCAGAGCAGCCTAGTCAGCAGGAGATCGAAGAGGCCGCCAAGATGGCCAACGCACACGAC
TTCATCACGCAGTTCCCGGACGGCTACGCGACCCAAGTGGGGATGAAGGGCGAGCAGCTGTCGGGCGGTCAGAAGCAGCGTATCGCCATCGCGCGAGCCA
TCCTCAAGAACCCCAACATCTTGCTGCTGGACGAAGCCACGAGCGCACTGGACTCGGAGAGCGAGAAGTGGTGCAGGAGGCGCTGGACAAGGTGGTGGCG
TTGAAGCGGCGCACGACGATCGTCATTGCTCACCGGTTGTCTACGATTCGTCACGCTGACAAGATCTGCGTGGTGAGCGGTGGCAAGATCGCGGAGCAGG
GCACGCACCAGGAACTGATCCAGCTCAATGGTATCTACGCGGGTCTGATAGAGTCGGCGTC