Description :
From Genome Similarity Track
Location :
Scaffold_257:22789- 24733
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_257-snap-gene-0.15Transmembrane protein

Sequence
1944 bases(100 bases per row)
CATTCTACTGCTGGTTTAAGGAAGGCCGCATCGTCTTGCTGCACTTCTACCTGTTCTACGTGCTCATGGTCGTGTTCATCATCGTGCTGCACGCACTCAT
TCGGAACAACATGAAGCGACGCGTTGCATGGTGCGTGATAACGTTGAACTTGCTATCACAGCTCTTCATTAATCGGCATGCGCTGCTTCTTGTATGTCAG
GCACGATACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCTCATTCGACGCAAGAGCTTGCTGTACATCGTGGTGTTCATCGT
TCATCGTGCGCCAATGATGTTCTACCGAAGTACGTCTATTCTTGCTGTACGTGTCAACTGTTTGCCACACTTCTAGTTTTCTCATGTGTGTGTATTTTTT
GTGCATGCACAGTATTTGAAACTATGGGCATCCAGAGCTTCATGTTCGGCCTCGTGGCGCAGATCATCTTGGACCTCGATGGGCTCTCGAACTCAATCGT
GTATGGCGGACTGTGTCGACGGGAGCCGTTTCAGCACGAGGACGAACTCCCGCGGGCGCGCACATTCCCCGCTGACAGTGTGTCGTCCCCCACGGAAAGC
GTTGACGACTTTTTTGCAAAGAAGCGGATCACTGTGTTTGACGACTTAGACGTGACGATGGGCACGGCGCTGATGAATGCAACGAGCAGCACGGTGAGCA
GCAGTATGAACTCGATGACGTTGTCGCGACCGTCGAATCTGTTCTCGAGCATGGAAGAAGTCATGATGCGGTCGTCGATCTTAAACTGTTTGTTGCCTCA
ACACGACCGTGCCAGTCGCAAGCGGAGCGCTGACAAGAACAAAAAGAAGAAACGACCGCAGACGCTGCCGCTCTTTGTCTCGACATTCAATATGGGCGAG
CAGAACGTGAACGAAGCGGAATTGGTAAGTCGCGCTTTATGACGAGCTACCAACCGTAGTTGCTAACTTGTATCTTCTTGCGCCTATTAGCCGGATTGGA
TTCCACTAGGTTACCAGATCTATGTCATTGGCGTGCAGGAATGCATGGACCTCTCAGATCTGCAGACAAAGATCCATCAATACCTCGTCGTTGGCTCGCA
GTGCAAGTTTGTATATTACTCGCGAGAGATTGGTAAGCGCGCGACGGCATTGGGGTACCATGGGTACATTGCGCTCACAGTGTTTGTGCGCGAAGATGCC
GTGCTGGACGGCCGGTTCCAGATGCCCTACCGTCCAAACACAAACAAAAGCGCGCAGGAAGTGTACCGTGGCAAGTCGCTGCTCGTATTTGGCCGCGCGT
CTAACAAAGGCGCCGTGGGTATGTCATTCCGATACGAGAACACGTCGTTTGCGTTCGCGACGTGCCACTTGGCGTCGGATTCTTCCAGCAATCGGTTGTC
CAAGCGCAAGAAATCGAGGGATGGCAAAGCGGCTCCGTCGAAATTTGAGCGCCGAAATCAGGACGCGATGGAGATCCTGCAGCAGTTGTACCTGGATGAT
GAGGACTACGGCTTTGGCTTTCCGTTGCTGCATCGTCACAGCTTCATTTTGGGCGATTTCAATTACCGCATGACGCGACAAGTAGCGAGTCCACAGGAGA
TCTTTGAGAGCTTGATCCGCACAGGCGAAGCGAACGCATTATCGGCGGAAAATGGGGACACTAGCAGCAGCACATTACCAGGCACGCCACAAAGTGAAGT
AGGACTGACGCCGACCACGTTGTGCGCATTTCAAGAATGTAGTACGCCGAAAAAAATCGAGACCAGCAAAAGTCTCGATCTGGTGTCACTTCTGGAAGAA
CACGACGAGCTCCATGCGCTGCGCAACAGCAACCAGTTGTTTTATGGCTTCAATGAGCCAAAGATCCATTTCTACCCGACTTTCCGTCGTGTCCGCGGCC
AGAAGCTGAATCCAAGCGACCCGAATTCGTTTTTGAGCAACTTC