Description :
From Genome Similarity Track
Location :
scaffold_62:22782- 26147
Transcript NameFunction/comments
Pl_110746conserved hypothetical protein
Pl_110747dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
3365 bases(100 bases per row)
GACGCCGCTGTGGCGCCCTCCATCGTCGTCGATGACCCGCTCTCCGCCCAAGTCAACGCGCCGTTCCCTATCAGTGCGCGGCTCAATGGCAAGATCTCGC
TTTGGCGCGGACCCCTCTACCGACTGCGCGTCGACGCCGTGGTGAACTCGACGTGCGAGTCCATGCGCGAAAGTGACGGAGACTTCGGCAAGCTGCTGAA
GGTTGCCGGACCGGAGATCGCAATCGAGTGCGAAGCCGCTGGAGCGTGTCGCACGGGGGACGCCGTTCTCACTCGAGGCTGCCAGTTGCCAGCCAAATTC
ATCCTGCACACGGTGGGACCGCGCTACCTGCCCAAGTACCACAACGCAGCAGAGCACGCGCTGCATTCGTGCTATCGCAGCGTGCTAACCGTCGCTAAGG
AGAACGGCCTGCGCTCAGTGGCGATTGGATGCATCTACACTCAGCACAAGAGTTATCCGCGCGAGGAAGCTGCTCATATAGCGGTGAGAACTGTGCGGCG
TTATCTAGAGCACTATGCGGATGACTTCGACAGGATTATTCTATGTATGAGTTCGACGCAAGATATGCTGGTGTACGAGAACATTTTGCCGCTTTACTTT
CCGCGGACGATAAATGAGCAACAGTCCCAGGAGATACTAGCGACGCGAGATCTCGGTTCGTATCTGCTCCTCGACAGCCCTACAACGACATTTCTAACAA
TATGGTTCGCTTCTAGGTGATAGTTTCGGTGAGCCCATTATTGCGGAGCGCAAGATCCGAATTGGCAATCTCAGCAACTCTTCTGTCGTTGATACTGACC
ATCGCAGCAACCAGTGCGAGTTCGAGAGCCTTAAAAGTGACAACAAGCCGGAAGAGATTCGTTTTTTATTTGACGGCACCGTGGTAGATATTGAAAACGA
GGAAACTGAGGGTGATATTCTGGCATTCCGGGCGATGCTAGCTGACCCAGACGCAGAGCGCCTAGGCAGGCTTCAGCAAATGCAAGAGGAGCGGCAGCGG
CGAGCAGCAGAGGTAGCAAATGAGGAGCAGAAACGACTCGAGAAAGCTGCAGCCAGCACAACAGAATGGGATTACCTTGCTGCACTTCAACGTGCGAGGA
ATGAGGATTTTTCGGACTTGAAAGCTCTCGAGTTTTGCTATTGTGGTGGGGTGGATCTGGCGGGATTACCCGTAATTGTCTATCTAGCTGGAAAGTTACG
AGTTGAGGATGTGGATCTGGAACGTGTGCTGCTGTTTGTGTTATTGACGCTTGACTCACAATGCTCGGCTTTAACTGCAACTAGTGCGCAGTTTAGCTTG
TTATACGTGCACTCAGACGTGACCATCGATAACCAGCCTCCTGCCTCCTGGCTCAAGCGATTATTTCGTGTATTCACTGCGGTAACAACACAACGAGTTC
CGAACGAGCATAGTAAAAGGGAGGAGCCTGCTCTTCGCTTTTTCTACGTGTTAGAACCTACTTTTGGATTCAAGTTTCAGCTGCTCTTGTCAAAGGGGTA
TTGCGACGGTGGGTTCTACAATCACGTAGTGTATCTGAAGCATCCAGAGATGTTAGACAACATCGCTCCAACTCTACAACTACCACCACATATCTACTCG
TAGGTGTTTGATTACCTTAGATTGGTTGCTCATTGACTAACCGTTTGGTGATGTTACTTGACAAGGTCCGGTAAATCTGGCATTGAGTCGACGCCTGAAA
CCGTATCGCCATAACTAATGTCGTGATGCATCTTATGTCTGTATGCTATTCCTTTCTAAAGTGTTGTGCCACGTTGATTAAATCTTGTCAGTATGACTAC
TTCTTCCACTTCGACGCGTGTTGCACGATCACCATGGATTGCGCATCGGAGCCTGCAACCAGTGTATCGGAGTCGGCATGAACTGCCAAAGCATTCCACG
GCTGGGACCCCGAGGCCAATGCTTGTACCTGAAGGCCTCCCAGTACCTTTGAAAACCCATTGGAAGGAACAACAACCTGAGAGCCGAACGGAGTCAAACT
CTGGTTAGCTGTAGACCCGCCGTAACGTTCGTACTCGACAGGGTCACGTGGGCTGCGACCATAGTGGAAGTCCCAGCAGTTTACCACGGCATCGTCACCT
CCCGTGTAAAGGTACTGAGGTGACGCAGAATGAAGCTTTAGCGCTCGAACAGCACGTTGATGGTGCACCTCGGTTCGGAATGGTGTGTCGAGTTTGCGGC
GGTCCCAAAAGCTTACGTGGCCGTCATTGGCGCCAGTAATCAGCAGTTCAGGCCGCGTTGGGTGAGTCTCTAGCGTAGTCAAGATGCTCCTCGAGGTAGG
GCTACGATAAAATTGTTTCAAGCAGCACGTTAGGACAGCATCACGACGTAGCAACGTATATCAACGTACTCTGTGCAGGTCGTGACAGGAAACTGGTTAT
TCGCTATGAGATCCCATATGCGAAGTTGGCCTCCTGGTGTCGATCTGTCAATGCAAATTAGCTCGTCGAAAGTAAAATCAATAGCACAAAAGCTCGAACG
TACCCGACAGTGGCAACAACGGTGTCGCGGCCCAAAAACTTGACTGCGTTGATCGGAAGTCTGCTCGTGTCCTTGTTTTCTACGAATCCGACCCCACAAT
GCGTAAGTTAACAGCACAACGCTTTCATTTTCTTCCTTGTCCCCCTACCAATCTTCTCGACGCTCACAGCATCATCAAGCCTTAACCACGCTAGAGCTCC
ACTGGCGCTGGCCGTCGCGAGGCTCGTGCGGTTCTCACTGACCTCCACACATGTGGCCGCAGTGCCAGCGAACAGCTTCTCCCACTGCGGGATAGCGAAT
GCGGATAGCGGCTTGTTCGACTCGCCACCAGTCATGGTAACATCCTCGTCTACTGCAGAGGAAGACACGCGGTAGGCGAAAATGCCTCCCGTAGACGATG
CACTGACCAGCAAATTCTCGCCTCTGGCTCTCACGAACCGCAGCGCGTTGACGTCTCCGTCATGTTCCGCCTCGGCCAACGTGTTCAGTTCACACGGAAG
GGCATCGCTCTCCCCACGGCTAGCAAATCAATTGACAGTCACTACGAGATCCACTACACAGCTATTCCAGTTACTGACGTACCCGAACTCTCTGCGTAGC
TCCCGTTCGTCGCGTGTGGGACGCGCAGGCAGATGCAGTGTCACGTGGTTGGTCTACAGAGAGTCAATAAGATCAGTTTGACTTCGAGCGAGATTATGGG
GACTATGGAGACACACCTCGTTGTCCCAGCCGCCGGTTGCCACAAGAGGGAGCACGTCGTATTCTTCCTGTAGCGTCTCGGACGCATAGCGGACGTCGCT
CACAAAGCACAGGGCCTTGACCTTCTCGGCCACAAAGTGCCTTGACAAGGACGCGCTCATGTTGC