Description :
From Genome Similarity Track
Location :
contig_30:227810- 230474
Transcript NameFunction/comments
g5312.t1hypothetical protein

Sequence
2664 bases(100 bases per row)
AATAAATTTTACTATTCTACGCTAACTATTTGCTAAATCTCAACTCACATTGAGCACAGCAGTGAGCCGCATACTACCCTGAGTAGACTGAGGGACCCAC
AGCAACAACGAACCACCTCCTGTACCGGGGAGACCCATAAAACCCGGACGCCACCGATCCAAATACAGCGTCTTGCCTCCCAGCCTCGTCACATTTGATT
TCCACATCACGGTCTGTCCAGCTGGAACGGGTACCTCGGCGACCTTGTCGCCGCCAGACTTGATGTTCACAGACACATCCTCGGTGTCAACGCTCTTGAA
TGTGACGATGACAGTTCCGTCGCCCTCCTTCTTCCACAAGCCGTCACTATTATTGAAGGCATCTTGCACAATTGTCATACCCAATGCTTTCTCCGCTGTA
CCGTCATCAATCTCACCGATGAGCTGTGTTGGGCCACAAATCGGCTGGAAAAACTCGGAAACAATGCCCGTGACAACCCACATATCCCAAATGGCATAAA
ATCCAAGGGCTTTGTCCGCAACCTTGAAAGCGTATTCCTTAGCACTAAGGAAGGTGCCATTGCTGCTCGTTCCTGAGCTGATCAGATCATCCATGATGCT
TGCAAACGTCTTGCGAAGGGTGTCGCGTGTGGCGTAGGCTGTTTTTTCGTCCGAATCCGCGATCAAATCGTTCATACAGTTGTTTGTCGCGATGGGGATA
TCCTTCAGCACCAGGTTCGATTGACTCATGGCCACGCGAATGTCATCTTCGGACATTCCCGGATTCGTTTTAAGCAATTCAGCCACGGTCATCCATGTGC
GATCCAACAGGCGCTTCATATCATATCCACAGGTGGAGTTGGACTCCATCGCGGACTTCAAACTGGTGATGTCGAACTGGTTTAACGAGCTGACGATTCA
CCGAGCGTGATGTTCTTCATGAACGATTCGAAATTGTCCCAACTTGAAACAATAGTATCGGAGTTTTTGACGGCTTCTCTCAGAATGAACTCTGCCGTTG
TGAGCACTCTGTCTGCAAACTTGACGCTGTCAGACACTTTGATCCCAAGACAGTAGGCTACTGCTACGGGTATGTCAATAACCACGTTGTCCGTCTGGTA
GAGCACTGCAAGAATCTTGTCTTGTGTTGACTCGGGGTCAGACACCTTGGCGTAGCGGATGTACTTGACCAGTGACTTGTCAAACCCAGCATGCTCTTAA
CGCACTTGAAGGCCTGCTGAATCCCTTTTGCCACTTTATAGAAAGCGCCGAAAAGATTCATCGTGACGAAGGACATTGTCGATTGAACCCACCGTTCCAA
CCTTGTAAGCAACTTCCAAAGCACAGTCGTCGTTCTGCCGGATGCACTCCAAACCGCATTCGACGGGGTACGAATACGGACACTGCGCCCAACACATCCC
ATGTTCGCTGTTGAATCCGAGCGGACACGTCTTCGCAATGTGAGACTCTCGATAACACACCGAGGTGAATGAAGTGTCGAGCTCGGAGCCGACCCAGTTG
ACGTACGTTGCCTCGATCGTACTGGTAGCGTTCATCACACTACCCGTCGTGAAAGCCACGCTCATGGCGTTCGAGGAAGCAGAAAAATCACTCGACCCGG
AGCCAGATACAGTTGAAGGCACGTCGTCGTCGCTGTCACTCGCTTCGTAGGACTAGTTTCAGATCCATCTTCATCATGTTCGTCACTGCTTGAAGAAAGT
GCGGCTTGAATTACGCTGTCGGTTGAGTCTGCATCATCGCTGTCTAGAGAATCGTTGTCACTTCCCGATGACTTGAAAGAGATCTTGGTGGACGTCAACG
CGCCAACGTCCGTGATATGTCAATGTCAATAGCGGCCGTCACTGTAGCAAGCGGAGTTGACGTCCTTGGCCACTCGTCCAGTGTTAGGATCTTCGCCGAA
GCGATTCCAACAAGTAATGCAGCGAAGACGGACAAGAGCATTGTCACCCTGGCCATCTGGATGGGTCTCGCGTCAGCGAGGAAGCTTGTTGAGCCTCAAG
TGGGACGAAACAAAGAATGAGGTGGTCGAGAGTGAATTGTTGAAACCTGCTCTCCGAAAACGAGTTTCTTTGTTGCAGTGTTTGTTGGTTACCGGTACTG
GACAAACGATCTTGTGCTGTGTCGGGTCACAACGGAGGGCGACTGCCCCGATTTCGCCAGATGAGCATACCGTGTTGTAAATCAGTTCCGGTGGACATGT
ACGTGTACTGCAGCGCGGTACTTCCCGTCTTCAACAATGCCACAGCAAATTCTTCCAATCATGCCCAAACCGTCCGCGGACTAGCACAGCTCGGCGCCAT
CCTACCATCTGCCTGCGGAGATACGACCACGCCGCGTGCGTCATGGATACTTTGTGATGCTCTCCTCCAGTCGCCTCCCCAGCGTTCCTGCTTGCTCAAA
ATATCTCCTGTGTAAACTCAGCGAGAGACGCCACATCTTGTGACGTGGGGTCTGTCGAGATCTGAACGGGGATTGGCATGCCCGTTCTCAAAAACGATGA
GGCGCGTAGATTAGCTCGCAGTCGCAAATTGCGACCCGCAAACGCGTGGATTGCCAGTGGTTTGCTGCGACTGCTACATGTACATGTACAAGATTTCGTG
GTGCTGTTGTGGGAGCGTGTTGCCGATTTGCGTTGACCTTTCCGCTGTTCGATAGCCAGCTCGA