Description :
From Genome Similarity Track
Location :
Scaffold_136:2278- 4608
Sequence
2330 bases(100 bases per row)
CGCCAGGGGTCTTCTCCAATCCAAACGCCACTCTGAGCTTCTTCTTCCATTGCCAGAGCTCGGCTCCGCCACGGGTCAGACTCCAGTCGGACAGAATGAG
GCTGTTTGGTCGGCTGTTGCACCGATAGCCCATCGCCTTCAACAGCAACACAGTTTCTTCCACCAACTGATTGATGTTGGCTGCACGCACCGGTTGAGTT
AACTCGGAACCCAACATCGGCCACTTCGCCTGCGCCATCGCCACAGGCGCGAACATCATCATCCATTCCGATCTCGTTCTCATCTCCTCGCCGAGTCGAG
CCAACACTTTATTGGCGCTCGGCGTATCGGCGTTCCTCGTCGCTTTCGGAATAAGGGGCGGACGGTCCCCTTGAGCAACGCCATGTTCTTCTTCATCTTC
TTCATCGTCCGCACCTTCGTCGAGCTCGGCGGATAAGCTGCGCTCGACAGGACGTGGGACTCCCATGCGTCCCACCTGCAGCGTCAACTCTTCCACCTCG
CCAAGTAGCTCGGCGGTAGTCTTCGTTTCTCCGAGCTCAGCGGTCTCGGCCTTCTCTTCATACTCTCCTTCACTTGCGTCTCAGTTCTCGCTCTCCTGGC
CTTGGCCATCCTCGTCGAACTGGACGGTTCGTCCCACCTCCATCGTCATGGCGATGAGTCGTTGATCCGCCGGGTCCGACCCCACGAGAGGCGATCCTCC
AGCCGTCGCTGGGCTTCCGTCGCTCGGAGTTGCTGATCCCTTGACCATCTTCACTCTTCTCTTTCTCTTCTCTTCCTCTTAACTTGGTTAGCTGGCACCT
ATAAAAACAAGCACACACTCCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTAGTAGAACACACAAATACCGTCAGATGTGGATTCCTTACACAAACCAC
AACGAATCGCCGAGTTAGTTCGGCGGTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGCTTCCACT
CGGTTCCGACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAGCCCTGTGCCCTCCACCAAAGGATGGACGA
CGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCTGCTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTATGC
GGGACTTTCTTTCGCGCGTAGCAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTATT
GACGGCAGGCATAATCCAGCCCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGAAAATTCTGCTCTGTTATCTTCTGGGAGCCTTT
TCGGCTCCTCCTATTTAATCCTATGCTTCTCATACAAATATCTAGTGAAATGTAGTCGTTTCGGATCTCTACCGACTCTTCAGGCGGCCGTTGAGCTCAA
CGGCTATCCGGATAGCATATCCGGACAGATCGCCGAGTACTTACCGTGATCCTTGGCTCCTAAGCTCTGGGTTATCAGACCGAGCCGATTCTTGACCTAA
AGTAGGTCGGCGTATGGTCGAATCTGGAAATCCCTACACCACACTAATAAGCACAAGAAATCGGATTCCAAGCAGCTCGTGGCCTTCATGAGGCTCTTCA
TCGAAGACGGGTACGTGCTCGACGAGTTATCATCCAGCTACAAAGATACAGTACGTCAGCTCGGAGAGTTAGCGTCAAACAAAGTCACAGTGTTCCTAGG
CGAGCAGGGCGTACCGTCAAAGGGATCCAACGCTGTGCTTAAGGTTCTTCGGCAGATGCACCGCGAAGCCAAGCTGAATAGTCTCATCAGTGCCTACCAT
CAGCGTTTTACCATCGGCAGAGTTGTAGACCCTACACCAACACAGCACCAAAGCATGCTCAAGCTGCTCCCGTAACACAATCCAATCTCTTTGTGTCCTT
GTAGCTGGTTCTTATATCATGTCAATCATGTAGAGACCTGCAAGGCATTCGAGCATAATTTTTTTACCAATGGGTGGATTTGAACCACCTCCTTCCCTTT
CGGGAGCTCTACCATTGAGCTACATCGGTGGGGGTTAGACAACAACAGCACAGGGATACTCATCTGGGTGCTCGACGGGGAATTAACGGTGATCCACTGT
TCTTTGTGGCCGCGACATACCCTCTTAGGTGTACCGATGCGCGGTACGCCCCCCTCAATTCACCGTTCCAGGTGGTCAATCGAGCACTGAGCTTGCAGGA
CAAAATGGCGCAGTCAATATTGCACCGGCG