Description :
From Genome Similarity Track
Location :
Scaffold_255:22778- 24762
Transcript NameFunction/comments
Albla_Nc14108780
Albla_Nc14108790
Albla_Nc14108800

Sequence
1984 bases(100 bases per row)
TTACTTCGAACAATTAAATTCTGAAGTTGATAATCACCAACCAAACCGTATCTGTACCGGTTGTCGCAATTCGAGGCACCATGACGAAGAAACTGTCAGG
TTTGGTGCTCTTCTCCCGATTGATTTTTATACCACAAAAGCTAAGAGGATCATGCAAAGTGCATCGTAGTTTAAAGTCGAAGCATCATCGATTAAAAGGA
GGCTTAAAAAGTAGAAATAAGCACGTTGGAACAGGGTATATTGTCTCGTTCATTGATGGGTATATGTATTCACTCACACGGAATTGATTACAGGAATCAA
GCTCAAGTTGAAGCATGCACAAGAAAAGCACCCAATTCCACTTCCAAGAAAGTAGTTAATCAATATCAAGACTATGAGGATCGGGTTGCTTGCATCAAGA
AGCATTCTCGAAATTCTCGCATTCTACCAAGTAGAAAGCCCATTATCGCGCCTCCTACATTCCAACTGTATGTAGTGGTATTCGAAATCTTCATACCTTA
TTTTCTTTTCTACATTCCGTGAAGTGCATCAAAGGACCCATTAACGCAATCGATCGACTATGTGAGTAATTTCAATATCATCGTTGAAATTCCTTCTTAT
TATATCCGCGAATTTGTAAAGGTCATAGAAGTCAATGCCAAAAGCAGTCGCCGATCTAGCAGCAGAAATCAAGATGGATTGGCATATAACAGCTCGAATA
TATTTTCAGTACTGGATGAAGACCATGGGAACAAAACGCGACATCTACAACCTCCAGTCATACAACCAGCAACGTTTTTACTGCCCGAACAACCAGCAAA
CATAAGCTCAAGTGCAAAATGCACAAAAGACTAAGAAATAGAAAATGTATATCTAAGGATTTTTAGAGATGCAGTAACTCATATAGAAGTCAATTTCACA
CACATGGCCGTTAGCACTCTAGCGATATTTCGTCAACAGTCAAGTACAAAAATGGTCGCAATACAAATAACGCCTCGAGCTTATTCTTCTCCATGCTTTA
TAAGCATTATTCGTCTTTGTCCTCTAAACCATATCCAGCCGACACTAAACTGAAAGGAAAACAATCGTTATTTTTGTCTTCTGGGAATGTCTGTGTGCTG
GTATTTGACTCAAAAAAAATCCGAATAAATCAGTTGAAGGAAGCCCTCCTTCTGCTGATTCGAGTCATACTTTTACCTTTTCTATCAGCCAAAATGCTTA
GCTGCAAGGATCGTTATCCTTAAGCATTCGAAAAGCTGCACAAAACTGAAAGTTTACGTTACATGATCTAATCTCTCTTCCTTAATACCAAAAGTATCGC
ATATGGTCAATTCTGTTGTTAAATCACACCGAAGTTAACCAAAGTCAGCGAAAATGAATCAGATTATTTCTTGGCCCCAGACTCGTTCAGCAAACGCTAC
AAAGTTGCACGAAATCTTGTAACAATGCAAGCCAGGACTGATGGCTTTAGGATCGACTTTTTTTTCGCGGGCGATTCTTTGCAGGGGTTTTGGCTCCAGA
CCTGTTTCGAGTTTCGGGAGCGGGTGGTAGCAAATGGATAGATGCGAGCTGTGGAAATGTCTGAAAGTACATATGAATCCATATAAATGCTTGAATCAGC
GCCAACGTCGGTTTCAATTGCGAACATCGGTCCTTTGCGATGACTAGCAGTTTGGGAGCGTCATCCATGACCAAAAACTTTCTCTTTCTCTGACCTGGTG
GTTTGTAACCCTTTTCTGGCCTGTGAAATTCGAACAGAATACTCCGATATTGAATTCGATAAGGGTGCACAACTTGAAGATACGTCGAACAGAGGGATGA
TGTTATTGTGTTTTTCAGAGCTTGTTGTGATATAAGATTGGTCTGGCGTTTCTCGACGCAAATAGTCCAAGCAGCGTTGAAAAAGTGTCTTAACAGCCAT
ACTCTTCCGCATTCGTACTGTTCTTGTGCCAGTTGTCTAGTTACTGTCGCAAAAGAGTGTAAGATACGTCGTCTCAATCGTCTG