Description :
From Genome Similarity Track
Location :
Scaffold_30:22772- 25545
Transcript NameFunction/comments
Phyca_LT1534548703ser/thr kinase
Phyca_LT153472675protein kinase
Phyca_LT1534116343predicted protein

Sequence
2773 bases(100 bases per row)
cggagatcgtgctgcccagtacagatgagtctcgccgcgagactccactcagtcccgagggccagaacttactgctccgactgctagagaaggacccaaa
ccagcggattacaattgcagaatgccttagccacccatggttcgcacaggatgacgacgaagaaccattatcgttttgacaaaagattgacaagttgccc
agttccgaaattttctttggaggttattcctcgagatgtcagttcttctggcgctatgtgcagcaaggatgactttgtatcattccgactattgcaacct
tttagttgtagttcgagcttaaaggtaagagtaaaggttgcaaaaggtaagagtaaaggttgcaagtaattcctgctctacagttaccggcatccagttg
gcgacagtcaaacacgcagtacagtgtgtactaagcactcacaataattgtgcggcaacgttgcctggtatggtcggtgaagtggccacattgtccattg
gtggtgacgtgaatgatggttcgttgaagtgatcagcaattcattacaggtaccacttgggtgcaactacttgaaacttttgattaaagttttctcagca
gactatggctacacgtacatggcgcaccattcgactatttcaccctcttaggccacgccaacaagaattgaagcttcattctgccttttaccagccaaga
cgcacatgaaacatgcatctattcaacactcagttcagtcacctgctcgcgcgagcaggtttgaagaaagaccagcgctcgcgaagacggtcaagaactc
ccggccgaacggctagaaaacggtggagagtacacgttcaaccttttcggcgatccagaaccaacaacttgtgcgcaatgctaacggaagattggttgat
cccccgacatgaaattcaaataatggactcgccgttccgcgtcggagggttcggcaagatttaccatggcatgtggctcgattctcgcgttgtcatcaag
ctgatcgacttggtgtccagtaaaacgcgtcgtgaattcctacgagaagccgcaatttggaaaaagcttcaccaccctcacgttatccagttgtacggtg
tctgtatgtcactcagcgaacaagcagacaaaccagggctcttcatttgcgaggaggccgagaacggcagtctgcgggactatttgttcaacgagaggga
agcgggcagatctccggtgtggcgaacccttcgtgacgcagcgttggggctacggtacctacaccaacgaggtatcgttcatggagatctcaaaggcaac
aacattctagtgagcaagtcaggcgttgcaaaactgacggattttggactaagttccatccctgatcaggaatgtagtgatccttgtgaagcggtcggcg
catttcaatggaaagctcccgagttgctgggagagaattgcagtgcagctacgtttgagtccgacatctacgctttcggcatgtgcgttgtcgaagcttt
acgaggtggatcaccgtggggaacgctgcccgatgctgcagtcaagtactgcctaaagaaggtcaagagagcggcgtccaagcccggaatgaaaatgaca
atttctcaagtgctgcctcgacctgtcaacgtgaagaataatgagcactgggcctttgtgaagcagctatgtgcattcgacccctctgaacgactgaagc
tcccagacgcgatcaaaatccttgaccaattcgctctggacgaagctacacaagccttttcgttattgtagtgtatctgttagtcaaaattgttgtggaa
cacatctacgtttatgcttgttcttcgattccaactcgctcgttgcgttgagtcttctcgttgtagcattcgtcaagcatttgttgagtaagttggaata
cttcgtgaacatgaacaccgtccatgccactccccgcaaatgggtcctccattatccgctcaacattgaagataccagtcatcagcaagcttgtcgacac
actgagcagcaagcagaaggcaaaattcgtcgcttggtactcgttaccacgcgcaatgtagacatagtacggtccgtagaacagtggcagtacaagaatg
aagagccgagtaaacgaccgagtggcttggggtgtccgatagaatttgatgttctggagcttctcaatacgagcttgcagtagccagtgatactggttaa
tccgcgaagcctcattcgctggcatgccacaggctttcatcacttccacttggtcatgcagctgatgaatcgtgtgtacgatctgtagctgcaaatgatt
gacaggggtaacaaactgcgaggcaagtttcctaccgtgcgaggtaaaccggtgacgtccacgtgtcaaagtaggcatgatcaacaacgacatcgtgtcg
tgtagcagcgcttccaacagcgtcttagtcttctggacatgatcctgaggcagcttcttccgtccgttatctccccaattccacagtgcatttgcaagca
aaatgttgacgagcaatgccttggactctgcaatgatgtctagagcttgttctctccgagtaaaggcctgtctgatctgcatgatcattggtgacacgac
tgcgaaggacacgatcgtccacgagatgttggctccgaagctcgggcccgtgctgctctcacccaagaaatagtataatgacgtggtgatcaccgagaaa
agtactacaaacagcccttcgaacgtgatgaggtggatgccgaaaacttttgacgcagcataaaggtccagga