Description :
From Genome Similarity Track
Location :
Scaffold_20:227684- 230936
Transcript NameFunction/comments
Hyaar_Emoy2803450hypothetical protein

Sequence
3252 bases(100 bases per row)
GGAGACAACAGAGACATTAAATGTCCTGGTCAATGACGGATCAAGTATAGGCACTTACCAACTTGATCTGATCGCGCCTCCGAAGACAACTTCGGAGATC
ACTTAATTGTCCACGCTCGAACGGAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGGAGACGAGTACGTAA
CCGATATTCGGTCGGCAATGGTATTTGCTGAAAACGAAAGGGTTCTTAGCATCTCATCAATAAACGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGAT
ACACGTCCCAATTGTGGGAATCGCTCGAGACAAATCCTCTCTACGATGATTTGACGGAATTCAGAGATGTGTTCCCAGAAACAGTGCCGTGCGAGCTACC
CAAGGATAAGAGTACTCGTCACGAGATCAACCTGAAACCAGGTATAAAGCACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAAAAAGTACTAGCGATT
GACAAATATTTGCCGATCGCTTGGCAGCGGGCCATGAGAGGGAATCTACTTCCCCACATAGCTCTCCGGTCTTCTGTGTCCGAAAGGCCACAGAAGGATG
GCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCAACTGTACCGGCTCAAACGCCGATGCCAAGAAAGGATGTCATTATAGATGGTATGTCAAGAAGT
ACCATCGATGGATCTGATGGACGGGTTCTATCAGATCCTTTTGCGTGAAAGGGACATCCCGTACACTTCCGTGAGCACCCCAAGCGGTATGCTTTGGGAG
TGGTTAGTAATGCCACAAGGGCTGAGTAACGCCCCTGCTACTTTCAACAGATGCGTTACGGATCTGTTGAGATCTGTGCGAGAATTCGCACCTAGATATT
TCGACGACGTGTTCGTCCATTGACGGGCTATGGATGAACAGACGGATTTGGAAGTCCACCGGCTCCACGTCCGAAATGTTCTTACACTGATGCGTGAGCA
TAAGTTGTATATCAACCTCAAGAAGTGCATATTTGCTGCAAGCGAAATACTACTTCGTCAATGCATCGTGGGTAAGCACGGCGTCCAGCCCAATCCGGAA
AAGATCAAGGAGATCACTGACTTGCCGGTTCCTACCGACATAAAAGGACTACGAAAGTTGCTTGGTCTAGCGGCGTATTTGCATAAATACTCGCACAATT
ACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGCCAGCGCTCTTTCGAAGGTATCGAAAAAAG
CTTGATACTCTCGCCAGTTTTGGCAATTGCAGACAGACCATTTCATGTGGTCTGCAATGCAAGTGATTTTGCCATCGGATGAGCACTAATGCAGTATGAC
ACAGACGGTGCTGAGCGTGTCGCCTGAAACCGGCGGAACGTAACTACCCAGTTCATGACAAGGAACTCCTTGCCATGAAGTATGCATTGGAGAAATTTAG
GGTCTACCTGCTAGGTGATAGACCCTTCATCATTTATACGGACCATACGTCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAGCGAATGGCGAGG
TGGCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAGCCAGGACGACTGAATGTCGTCGCTGATGCTCTGTCGCGCCGGCCCGATTTTGAAC
CGGCTGTGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGAAGTTGAGTGTCCCGTTGTCAACCTTATTCGAAGACATACGCAAGGCGTATGATCC
GGCGATAATGCGTTTGATGGATCATCTCTCGCAACCATCCCGTCAAACCTTGAAGGGTTGCTCCCAGTATATCGATCCTCCACGGATAGATATACAGTCC
ACAATTACTTACTGAAGTATTCCGTCGTTACCGGCGACACGCCACGTGTCGTCGTACTGGAACATGGTGACCTGCGACTGCGCATCATGTATGAGTACCA
CGATGCACCTACTGGTGGGCATCGTGGTCGAGAGAAGACATATCTCACGGTTAGTCGCGACTTTTACTGGCCCCGCCATTATCAAAATGTGCGTAAGTAA
GTGCGCGCATGCGAAGTATGTCAACGAGTGAAATCTGGTCCTTCACTTCGTGAACCATTGCAACCCTTGCCCATTCCGGCAGAATGCTGGGAATCAGTCT
CAATGGACTTTGTCTTTGGATTCCCCGCAGACCCTCACAAGAATACAGGTATTCTTGTCTACGTTGATAGCTTCAGTAAAATGGTACACCTGGTCGCTGT
ACCTGAATCTATTAATGCATCGGCATGTGCTCGTGTTTTTATTGACACGATCTTTCGTCTTCATGGGCTGCCTCGTGAACTCGTCTCCGATAGAGATCCA
CAGTTCACTGCTGAATTCTGGCGATCCGTGTTCAAAACACTCGGAATGCGCCTTCAGATGTCGACCTCTGACCACCTGAAACAGATGGTCAGACAGAACG
TGCAAACCGCGTTCTTGAGGAAATCCGTCGGGGTTATGTCCATTCGTTTACGAATTGGAGCGAATTCTTGCCAATGGTGGAAACCACCATGAACAACTTG
GTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGTACCACCCACGCCTACCCACCTTCTTAGAGTGTAACTCTAGTTTGAGGGGGGAGG
GAATCATTCGAGCGAACGCCAACTCGGCTCTCACTCATCACGTATTGACCACGAGGTCACTACGTATGACGTCGATGTCGATCACATCGACTTCGGTGAA
GAAGAGGAAAGTAAGAGCGAGGGTGCTCTTACTACTCAGGTCACTGATCTTGCCGCAGTGCGCTCCAAGCGCACTAAGCGCACTACAGCAAAAGACAGCG
AGTCAGCAGATGAATTCATACTGGCTAGCGAAACGGTTGTCCGTTTCGTACAAGATTCCATTGCAGAAGCGGTGGACCGGCAAAAGAAAAACGCTGACAA
GAATGGAAGAGAAAATATTCTTTTATTCAATGAAGGTGACCTATTCCTACTATCTACGGTAAACTTACCTCCACACATAGTGACTAACGTGGGTAGTAAC
AAGTTACTACCCAAGTTCATCGGTCCATTTAGTGTGCTGCGCCGCATAGGCAACGCATACACGATTGAACTGCCACGTAAGATGCGCACGCATCCTAAGT
TCTACGTCCATCGCCTTAGGCTTTATAACCAGTACAGGACTTCTCCTGGTGA